Streptococcus agalactiae

From ICG
Jump to navigation Jump to search

Description

Streptococcus agalactiae-1.jpg
  • Streptococcus agalactiae, group B streptococci (GBS), is a leading cause of bacterial sepsis and meningitis in neonates from industrialized countries, and an emerging pathogen in nonpregnant adults.
  • GBS expression studies allowed the identification and characterization of virulence factors and a better understanding of the host pathogen–environment interactions. [1]
  • Common Name: Unknown
  • NCBI Taxonomy

Growth Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
recA[1] Recombinase A
  • Different temperature conditions (37 °C and 40 °C)
NA
  • F:ATTCAGGCGCAGTTGATTTAGTT
  • R:TCAATCTCAGCACGAGGAACA
67 60 SYBR
sdhA[1] Serine dehydratase
  • Different temperature conditions (37 °C and 40 °C)
NA
  • F:TGTGAAGCGGAATGCTCTTG
  • R:TGGAATTTGCGATTCAATACCA
82 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: J.P. Gomes
  • Email: j.paulo.gomes@insa.min-saude.pt
  • Institute: Department of Infectious Diseases, National Institute of Health, Av. Padre Cruz, 1649–016, Lisbon, Portugal

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. 1.0 1.1 1.2 Florindo C, Ferreira R, Borges V, Spellerberg B, Gomes JP, Borrego MJ. Selection of reference genes for real-time expression studies in Streptococcus agalactiae. J Microbiol Methods. 2012 Sep;90(3):220-7.

Categories