Difference between revisions of "Symbiodinium"

From ICG
Jump to navigation Jump to search
 
(17 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
[[File:Symbiodinium.png|right|200px|link=Symbiodinium]]
[[File:Symbiodinium-1.png|right|327px|]]
+
* '''''Symbiodinium''''' is a genus of phototrophic, peridin-containing dinoflagellates that live as endosymbionts (zooxanthellae) in a wide variety of tropical marine invertebrates. Symbiodinium is responsible for the majority of primary production in coral reefs and found in a mutualistic symbiosis with multiple animal phyla. The genus Symbiodinium encompasses eight lineages (clades A–H), and multiple sub-clade types. Symbiodinium in clades A, B, C, and D are most commonly associated with metazoan hosts while clades C, D, F, G, and H with large soritid foraminifera<ref name="ref1"/><ref name="ref2"/>.
* Symbiodinium are responsible for the majority of primary production in coral reefs and found in a mutualistic symbiosis with multiple animal phyla.
 
* The genus Symbiodinium encompasses eight lineages (clades A–H), and multiple sub-clade types. Symbiodinium in clades A, B, C, and D are most commonly associated with metazoan hosts while clades C, D, F, G, and H with large soritid foraminifera<ref name="ref1"/> <ref name="ref2"/> .
 
 
* <font color=blue>'''Common Name:'''</font> '''Zoox''', '''Zooxanthellae'''
 
* <font color=blue>'''Common Name:'''</font> '''Zoox''', '''Zooxanthellae'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=2949 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=2949 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Abiotic Stress'''''==
 
=='''''Abiotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 56: Line 54:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''48''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=4211511702569045836&as_sdt=2005&sciodt=0,5&hl=en'''49'''] (Based on Google Scholar [2017-09-01])
 +
 
 +
=='''''Abiotic Stress'''''==
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25% font-size:9pt "|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| pcna<ref name="ref3"/>
 +
|align="center"| Proliferating cell nuclear antigen
 +
|
 +
*Cryopreservation
 +
|align="center"| NA
 +
|nowrap style="font-size:9pt"|
 +
* F:GAGTTTCAGAAGATTTGCCGAGAT
 +
* R:ACATTGCCACTGCCGAGGTC
 +
|align="center"| 113
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| ps1<ref name="ref3"/>
 +
|align="center"| Photosystem I (subunit III)
 +
|
 +
*Cryopreservation
 +
|align="center"| NA
 +
|nowrap style="font-size:9pt"|
 +
* F:GTGGAGTTGACATTGACTTGGA
 +
* R:TGCTGCTTGGTGGTCTTGTA
 +
|align="center"| 136
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|}
 +
 
 +
===Molecular Types===
 +
* mRNA
 +
 
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Chiahsin Lin
 +
*'''Email''': chiahsin@nmmba.gov.tw
 +
*'''Institution''': Institute of Marine Biology, National Dong Hwa University
 +
===Citation Statistics===
 +
Cited by '''0''' (Based on Google Scholar [2017-08-10])
  
 
=='''References'''==
 
=='''References'''==
Line 65: Line 115:
 
<ref name="ref2">
 
<ref name="ref2">
 
Pochon X, Gates RD. A new Symbiodinium clade (Dinophyceae) from soritid foraminifera in Hawai'i. Mol Phylogenet Evol. 2010 Jul;56(1):492-7. doi: 10.1016/j.ympev.2010.03.040. Epub 2010 Apr 4. PMID: 20371383 DOI: 10.1016/j.ympev.2010.03.040.
 
Pochon X, Gates RD. A new Symbiodinium clade (Dinophyceae) from soritid foraminifera in Hawai'i. Mol Phylogenet Evol. 2010 Jul;56(1):492-7. doi: 10.1016/j.ympev.2010.03.040. Epub 2010 Apr 4. PMID: 20371383 DOI: 10.1016/j.ympev.2010.03.040.
 +
</ref>
 +
<ref name="ref3">
 +
Chong, Gabriella, et al. "Validation of reference genes for cryopreservation studies with the gorgonian coral endosymbiont Symbiodinium." Scientific reports 7 (2017): srep39396.
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]]
 
[[Category:mRNA]]
 
  
[[Category:SYBR]]
+
=='''Categories'''==
[[Category:RPS]] [[Category:SAM]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:RPS]] [[Category:SAM]][[Category:Abiotic Stress]][[Category:Thermal Treatment]][[Category:Cold Treatment]]
[[Category:Abiotic Stress]] [[Category:Temperature Treatment]]
+
[[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]]

Latest revision as of 07:57, 1 September 2017

Description

Symbiodinium.png
  • Symbiodinium is a genus of phototrophic, peridin-containing dinoflagellates that live as endosymbionts (zooxanthellae) in a wide variety of tropical marine invertebrates. Symbiodinium is responsible for the majority of primary production in coral reefs and found in a mutualistic symbiosis with multiple animal phyla. The genus Symbiodinium encompasses eight lineages (clades A–H), and multiple sub-clade types. Symbiodinium in clades A, B, C, and D are most commonly associated with metazoan hosts while clades C, D, F, G, and H with large soritid foraminifera[1][2].
  • Common Name: Zoox, Zooxanthellae
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Rp-S4 [1] Ribosomal protein S4
  • Thermal stress
EH036413
  • F:CCGCACAAACTGCGTGAGT
  • R:CGCTGCATGACGATCATCTT
101 58~59 SYBR
SAM[1] S-adenosyl-L-methionine synthetase
  • Thermal stress
EH036622
  • F:GCCTACATTTGCCGACAGATG
  • R:AATGGCTTGGCAACACCAAT
101 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ove Hoegh-Guldberg
  • Email: n.rosic@uq.edu.au
  • Institution: Global Change Institute, University of Queensland, St. Lucia, Brisbane 4072( QLD, Australia

Citation Statistics

Cited by 49 (Based on Google Scholar [2017-09-01])

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
pcna[3] Proliferating cell nuclear antigen
  • Cryopreservation
NA
  • F:GAGTTTCAGAAGATTTGCCGAGAT
  • R:ACATTGCCACTGCCGAGGTC
113 60 SYBR
ps1[3] Photosystem I (subunit III)
  • Cryopreservation
NA
  • F:GTGGAGTTGACATTGACTTGGA
  • R:TGCTGCTTGGTGGTCTTGTA
136 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Chiahsin Lin
  • Email: chiahsin@nmmba.gov.tw
  • Institution: Institute of Marine Biology, National Dong Hwa University

Citation Statistics

Cited by 0 (Based on Google Scholar [2017-08-10])

References

  1. 1.0 1.1 1.2 Rosic N N, Pernice M, Rodriguez-Lanetty M, et al. Validation of housekeeping genes for gene expression studies in Symbiodinium exposed to thermal and light stress[J]. Marine biotechnology, 2011, 13(3): 355-365.
  2. Pochon X, Gates RD. A new Symbiodinium clade (Dinophyceae) from soritid foraminifera in Hawai'i. Mol Phylogenet Evol. 2010 Jul;56(1):492-7. doi: 10.1016/j.ympev.2010.03.040. Epub 2010 Apr 4. PMID: 20371383 DOI: 10.1016/j.ympev.2010.03.040.
  3. 3.0 3.1 Chong, Gabriella, et al. "Validation of reference genes for cryopreservation studies with the gorgonian coral endosymbiont Symbiodinium." Scientific reports 7 (2017): srep39396.

Categories