Difference between revisions of "Symbiodinium"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Symbiodinium-1.png|right|230px|]]
+
[[File:Symbiodinium.png|right|200px|link=Symbiodinium]]
 
* '''''Symbiodinium''''' is a genus of phototrophic, peridin-containing dinoflagellates that live as endosymbionts (zooxanthellae) in a wide variety of tropical marine invertebrates. Symbiodinium is responsible for the majority of primary production in coral reefs and found in a mutualistic symbiosis with multiple animal phyla. The genus Symbiodinium encompasses eight lineages (clades A–H), and multiple sub-clade types. Symbiodinium in clades A, B, C, and D are most commonly associated with metazoan hosts while clades C, D, F, G, and H with large soritid foraminifera<ref name="ref1"/><ref name="ref2"/>.
 
* '''''Symbiodinium''''' is a genus of phototrophic, peridin-containing dinoflagellates that live as endosymbionts (zooxanthellae) in a wide variety of tropical marine invertebrates. Symbiodinium is responsible for the majority of primary production in coral reefs and found in a mutualistic symbiosis with multiple animal phyla. The genus Symbiodinium encompasses eight lineages (clades A–H), and multiple sub-clade types. Symbiodinium in clades A, B, C, and D are most commonly associated with metazoan hosts while clades C, D, F, G, and H with large soritid foraminifera<ref name="ref1"/><ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Zoox''', '''Zooxanthellae'''
 
* <font color=blue>'''Common Name:'''</font> '''Zoox''', '''Zooxanthellae'''

Revision as of 03:47, 29 June 2017

Description

Symbiodinium.png
  • Symbiodinium is a genus of phototrophic, peridin-containing dinoflagellates that live as endosymbionts (zooxanthellae) in a wide variety of tropical marine invertebrates. Symbiodinium is responsible for the majority of primary production in coral reefs and found in a mutualistic symbiosis with multiple animal phyla. The genus Symbiodinium encompasses eight lineages (clades A–H), and multiple sub-clade types. Symbiodinium in clades A, B, C, and D are most commonly associated with metazoan hosts while clades C, D, F, G, and H with large soritid foraminifera[1][2].
  • Common Name: Zoox, Zooxanthellae
  • NCBI Taxonomy

Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Rp-S4 [1] Ribosomal protein S4
  • Thermal stress
EH036413
  • F:CCGCACAAACTGCGTGAGT
  • R:CGCTGCATGACGATCATCTT
101 58~59 SYBR
SAM[1] S-adenosyl-L-methionine synthetase
  • Thermal stress
EH036622
  • F:GCCTACATTTGCCGACAGATG
  • R:AATGGCTTGGCAACACCAAT
101 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ove Hoegh-Guldberg
  • Email: n.rosic@uq.edu.au
  • Institution: Global Change Institute, University of Queensland, St. Lucia, Brisbane 4072( QLD, Australia

Citation Statistics

Cited by 48 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Rosic N N, Pernice M, Rodriguez-Lanetty M, et al. Validation of housekeeping genes for gene expression studies in Symbiodinium exposed to thermal and light stress[J]. Marine biotechnology, 2011, 13(3): 355-365.
  2. Pochon X, Gates RD. A new Symbiodinium clade (Dinophyceae) from soritid foraminifera in Hawai'i. Mol Phylogenet Evol. 2010 Jul;56(1):492-7. doi: 10.1016/j.ympev.2010.03.040. Epub 2010 Apr 4. PMID: 20371383 DOI: 10.1016/j.ympev.2010.03.040.