Difference between revisions of "Symbiodinium"

Revision as of 09:00, 19 June 2017

Symbiodinium are responsible for the majority of primary production in coral reefs and found in a mutualistic symbiosis with multiple animal phyla.
The genus Symbiodinium encompasses eight lineages (clades A–H), and multiple sub-clade types. Symbiodinium in clades A, B, C, and D are most commonly associated with metazoan hosts while clades C, D, F, G, and H with large soritid foraminifera^[1] ^[2] .

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
Rp-S4 ^[1]	Ribosomal protein S4	Thermal stress	EH036413	F:CCGCACAAACTGCGTGAGT R:CGCTGCATGACGATCATCTT	101	58~59	SYBR
SAM^[1]	S-adenosyl-L-methionine synthetase	Thermal stress	EH036622	F:GCCTACATTTGCCGACAGATG R:AATGGCTTGGCAACACCAAT	101	59	SYBR

Name: Ove Hoegh-Guldberg
Email: n.rosic@uq.edu.au
Institute: Global Change Institute, University of Queensland, St. Lucia, Brisbane 4072( QLD, Australia

Cited by 48 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 Rosic N N, Pernice M, Rodriguez-Lanetty M, et al. Validation of housekeeping genes for gene expression studies in Symbiodinium exposed to thermal and light stress[J]. Marine biotechnology, 2011, 13(3): 355-365.
↑ Pochon X, Gates RD. A new Symbiodinium clade (Dinophyceae) from soritid foraminifera in Hawai'i. Mol Phylogenet Evol. 2010 Jul;56(1):492-7. doi: 10.1016/j.ympev.2010.03.040. Epub 2010 Apr 4. PMID: 20371383 DOI: 10.1016/j.ympev.2010.03.040

Revision as of 02:39, 19 June 2017 (view source) ICG Expert4 (talk \| contribs) (→‎Reference Genes) ← Older edit		Revision as of 09:00, 19 June 2017 (view source) ICG Expert3 (talk \| contribs) (→‎References) Newer edit →
Line 67:		Line 67:

	[[Category:SYBR]]		[[Category:SYBR]]
		+	[[Category:RPS]] [[Category:SAM]]