Difference between revisions of "Symbiodinium"

From ICG
Jump to navigation Jump to search
Line 67: Line 67:
  
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 +
[[Category:RPS]] [[Category:SAM]]

Revision as of 09:00, 19 June 2017

Description

Symbiodinium-1.jpg
  • Symbiodinium are responsible for the majority of primary production in coral reefs and found in a mutualistic symbiosis with multiple animal phyla.
  • The genus Symbiodinium encompasses eight lineages (clades A–H), and multiple sub-clade types. Symbiodinium in clades A, B, C, and D are most commonly associated with metazoan hosts while clades C, D, F, G, and H with large soritid foraminifera[1] [2] .

Thermal & Light Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Rp-S4 [1] Ribosomal protein S4
  • Thermal stress
EH036413
  • F:CCGCACAAACTGCGTGAGT
  • R:CGCTGCATGACGATCATCTT
101 58~59 SYBR
SAM[1] S-adenosyl-L-methionine synthetase
  • Thermal stress
EH036622
  • F:GCCTACATTTGCCGACAGATG
  • R:AATGGCTTGGCAACACCAAT
101 59 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ove Hoegh-Guldberg
  • Email: n.rosic@uq.edu.au
  • Institute: Global Change Institute, University of Queensland, St. Lucia, Brisbane 4072( QLD, Australia

Citation Statistics

Cited by 48 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Rosic N N, Pernice M, Rodriguez-Lanetty M, et al. Validation of housekeeping genes for gene expression studies in Symbiodinium exposed to thermal and light stress[J]. Marine biotechnology, 2011, 13(3): 355-365.
  2. Pochon X, Gates RD. A new Symbiodinium clade (Dinophyceae) from soritid foraminifera in Hawai'i. Mol Phylogenet Evol. 2010 Jul;56(1):492-7. doi: 10.1016/j.ympev.2010.03.040. Epub 2010 Apr 4. PMID: 20371383 DOI: 10.1016/j.ympev.2010.03.040