Symbiodinium

From ICG
Revision as of 14:08, 16 June 2017 by Xysj2012 (talk | contribs) (Created page with "=='''Description'''== =='''''Thermal & Light Stress'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Nam...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Thermal & Light Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Rp-S4 [1] Ribosomal protein S4

Thermal stress

EH036413
  • F:CCGCACAAACTGCGTGAGT
  • R:CGCTGCATGACGATCATCTT
101 58~59 SYBR
SAM[1] S-adenosyl-L-methionine synthetase

Thermal stress

EH036622
  • F:GCCTACATTTGCCGACAGATG
  • R:AATGGCTTGGCAACACCAAT
101 59 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Ove Hoegh-Guldberg
  • Email: n.rosic@uq.edu.au
  • Institute: Global Change Institute, University of Queensland, St. Lucia, Brisbane 4072( QLD, Australia

References

  1. 1.0 1.1 Rosic N N, Pernice M, Rodriguez-Lanetty M, et al. Validation of housekeeping genes for gene expression studies in Symbiodinium exposed to thermal and light stress[J]. Marine biotechnology, 2011, 13(3): 355-365.