Difference between revisions of "Syntrichia caninervis"

From ICG
Jump to navigation Jump to search
Line 68: Line 68:
  
 
[[Category:Plants]]
 
[[Category:Plants]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 07:45, 19 June 2017

Description

REFqPCR2015012-1.jpg
  • Syntrichia caninervis is the dominant bryophyte of the biological soil crusts found in the Gurbantunggut desert. The extreme desert environment is characterized by prolonged drought, temperature extremes, high radiation and frequent cycles of hydration and dehydration. S. caninervis is an ideal organism for the identification and characterization of genes related to abiotic stress tolerance.
  • Syntrichia caninervis is a desert moss and the dominant bryophyte of the biological soil crusts found in the Gurbantunggut desert of Northwestern China. The Gurbantunggut has a mean annual precipitation of ∼79.5 mm and a mean annual evaporation of 2,606.6 mm. S. caninervis has gained particular attention due to its extreme desiccation tolerance and is closely related to Tortula ruralis. T. ruralis is a model DT moss and many desiccation-related genes have been isolated and analyzed in this species T. ruralis.
  • Syntrichia caninervis Mitt. is the dominant species in the moss crusts of the Gurbantunggut Desert, Northwestern China. We experimented with this species under controlled environmental conditions. Modulated chlorophyll (Chl) fluorescence was used to test the speed of recovery as evidenced by the time course of photosynthetic activity following remoistening. Transmission electron microscopy was used to explore the cytological characteristics of the leaf cells. [1] [2].

Abiotic Stress and Desiccation/Rehydration

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
α-TUB2[1] alpha-tubulin
  • Hydration-desiccation-rehydration process
KJ398824
  • F:CGGTCATTACACCGTGGGAA
  • R:CGGTCATTACACCGTGGGAA
154 60 SYBR
TUB1[1] alpha-tubulin
  • Abiotic stress treatments
KJ398823
  • F:CGTCGTCTATGATGGCGAAGT
  • R:CGTCGTCTATGATGGCGAAGT
117 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Daoyuan Zhang
  • Email: zhangdy@ms.xjb.ac.cn
  • Institution: Key Laboratory of Biogeography and Bioresource in Arid Land, Xinjiang Institute of Ecology and Geography – Chinese Academy of Sciences, Ürümqi, China

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Zhang J, Zhang YM, Downing A, Wu N, Zhang BC (2011) Photosynthetic and cytological recovery on remoistening Syntrichia caninervis Mitt., a desiccation-tolerant moss from Northwestern China. Photosynthetica 49, 13-20.
  2. Li X, Zhang D, Li H, et al. (2015) Characterization of reference genes for RT-qPCR in the desert moss Syntrichia caninervis in response to abiotic stress and desiccation/rehydration. Front Plant Sci 6, 38.