Difference between revisions of "Talaromyces marneffei"

From ICG
Jump to navigation Jump to search
 
(5 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Talaromyces marneffei-1.jpg|right|200px|link=Talaromyces marneffei]]
 
[[File:Talaromyces marneffei-1.jpg|right|200px|link=Talaromyces marneffei]]
*'''''Talaromyces marneffei''''' (or ''Penicillium marneffei'') is an opportunistic pathogen that can cause disseminated disease in human immunodeficiency virus (HIV)-infected patients, especially in Southeast Asia. ''T. marneffei'' is a thermally dimorphic fungus. Typically, ''T. marneffei'' has an adaptive morphology. It grows in a filamentous form (mould) at 25 °C and can differentiate to produce asexual spores (conidia). In contrast, at 37 °C, it grows as yeast cells that divide by fission<ref name="ref1"/>.
+
*'''''Talaromyces marneffei''''' (or ''Penicillium marneffei'') is an opportunistic pathogen that can cause disseminated disease in human immunodeficiency virus (HIV)-infected patients, especially in Southeast Asia. ''T. marneffei'' is a thermally dimorphic fungus. Typically, ''T. marneffei'' has an adaptive morphology. It grows in a filamentous form (mould) at 25 °C and can differentiate to produce asexual spores (conidia). In contrast, at 37 °C, it grows as yeast cells that divide by fission <ref name="ref1"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Unknown'''
 
* <font color=blue>'''Common Name:'''</font> '''Unknown'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=37727&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=37727&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>]
Line 25: Line 25:
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:TgATgAggCACAgTCTAAgC
+
* F:TGATGAGGCACAGTCTAAGC
* R:CTTCTCTCTgTTggACTTgg
+
* R:CTTCTCTCTGTTGGACTTGG
 
|align="center"| 155
 
|align="center"| 155
 
|align="center"| 61~63
 
|align="center"| 61~63
Line 32: Line 32:
 
|}
 
|}
  
===Moleculer types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 40: Line 41:
 
*'''Name''': Nongnuch Vanittanakom
 
*'''Name''': Nongnuch Vanittanakom
 
*'''Email''': NA
 
*'''Email''': NA
*'''Institute''': Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand
+
*'''Institution''': Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''??''' (Based on Google Scholar [2017-08-01])
+
Cited by [https://scholar.google.com/scholar?cites=11859984207399441876&as_sdt=2005&sciodt=0,5&hl=en '''5'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==

Latest revision as of 05:30, 1 September 2017

Description

Talaromyces marneffei-1.jpg
  • Talaromyces marneffei (or Penicillium marneffei) is an opportunistic pathogen that can cause disseminated disease in human immunodeficiency virus (HIV)-infected patients, especially in Southeast Asia. T. marneffei is a thermally dimorphic fungus. Typically, T. marneffei has an adaptive morphology. It grows in a filamentous form (mould) at 25 °C and can differentiate to produce asexual spores (conidia). In contrast, at 37 °C, it grows as yeast cells that divide by fission [1].
  • Common Name: Unknown
  • NCBI Taxonomy

Specific Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
act[1] β-actin
  • Different cell types
  • All growth forms
NA
  • F:TGATGAGGCACAGTCTAAGC
  • R:CTTCTCTCTGTTGGACTTGG
155 61~63 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Nongnuch Vanittanakom
  • Email: NA
  • Institution: Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Dankai W, Pongpom M, Vanittanakom N. Validation of reference genes for real-time quantitative RT-PCR studies in Talaromyces marneffei. J Microbiol Methods. 2015 Nov;118:42-50.

Categories