Difference between revisions of "Test1"

From ICG
Jump to navigation Jump to search
(Blanked the page)
 
(2 intermediate revisions by the same user not shown)
Line 1: Line 1:
 +
=='''Synonymous Genes'''==
 +
* ACT <=> Actin, Actin7, beta-actin, Actin 11, Actin1, Actin2, Actin3, Actin5, β-actin, Actin42A, Actin-11, Actin 101, Actin-11, β-actin1, β-actin2
  
 +
=='''Applicable Species'''==
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Species 
 +
! Gene Synonymous 
 +
! Application scenarios
 +
! Publication
 +
! Year
 +
|-
 +
|align="center"|[[Actinidia chinensis]]
 +
|align="center"|Actin
 +
||
 +
* ''Different Developmental Stages & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26897117 Identification and validation of reference genes for accurate normalization of real-time quantitative PCR data in kiwifruit]
 +
|align="center"|2016
 +
|-
 +
|align="center"|[[Agrostis stolonifera]]
 +
|align="center"|Actin7
 +
||
 +
* ''Abiotic Stresses''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26179072 Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Aphis gossypii]]
 +
|align="center"|beta-actin
 +
||
 +
* ''Different Developmental Stages & Geographical Populations''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/28076279 Identification and Validation of Reference Genes for the Normalization of Gene Expression Data in qRT-PCR Analysis in Aphis gossypii (Hemiptera: Aphididae).]
 +
|align="center"|2016
 +
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCC
 +
GCCGCCAGCTCACCATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGC
 +
CGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCACCAGGGC
 +
GTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTCA
 +
CCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACAC
 +
CTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCC
 +
AAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTA
 +
TCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGT
 +
CACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGC
 +
CGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGC
 +
GGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCAC
 +
GGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAAT
 +
GAGCGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACG
 +
AAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCT
 +
GTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTGGCACCC
 +
AGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCATCC
 +
TGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGGCCCCTCCAT
 +
CGTCCACCGCAAATGCTTCTAGGCGGACTATGACTTAGTTGCGTTACACCCTTTCTTGACAAAACCTAAC
 +
TTGCGCAGAAAACAAGATGAGATTGGCATGGCTTTATTTGTTTTTTTTGTTTTGTTTTGGTTTTTTTTTT
 +
TTTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATC
 +
CCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTTTTTAATAGTCATTCCAAATA
 +
TGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGGAGAATGGC
 +
CCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCATTGCTTTCGTGTAAATTATGTAATGCAAAAT
 +
TTTTTTAATCTTCGCCTTAATACTTTTTTATTTTGTTTTATTTTGAATGATGAGCCTTCGTGCCCCCCCT
 +
TCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGAGTGGGTGGAGGCAG
 +
CCAGGGCTTACCTGTACACTGACTTGAGACCAGTTGAATAAAAGTGCACACCTTAAAAATGAAAAAAAAA
 +
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 +
</dnaseqindica>|
 +
SOURCE = '''''Homo sapiens''''' ACT|
 +
 +
}}
 +
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Homo sapiens''''' ACT|
 +
Str= [[File:ACT.png|center|770px|link=http://icg.big.ac.cn/index.php/Gene:ACT]]|
 +
}}
 +
 +
=='''External Links'''==
 +
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=smart00268 NCBI Conserved Protein Domain Family]
 +
* [https://en.wikipedia.org/wiki/Actin WikiPedia]
 +
* [http://pfam.xfam.org/family/PF00022 Pfam]
 +
* [https://www.ebi.ac.uk/interpro/entry/IPR004000 InterPro]
 +
* [http://smart.embl-heidelberg.de/smart/do_annotation.pl?BLAST=DUMMY&DOMAIN=SM00268 SMART]

Latest revision as of 08:58, 1 September 2017

Synonymous Genes

  • ACT <=> Actin, Actin7, beta-actin, Actin 11, Actin1, Actin2, Actin3, Actin5, β-actin, Actin42A, Actin-11, Actin 101, Actin-11, β-actin1, β-actin2

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Actinidia chinensis Actin
  • Different Developmental Stages & Tissues
2016
Agrostis stolonifera Actin7
  • Abiotic Stresses
2015
Aphis gossypii beta-actin
  • Different Developmental Stages & Geographical Populations
2016

Featured Sequence

The Sequence of Homo sapiens ACT is displayed as example.

000001 ACCGCCGAGA CCGCGTCCGC CCCGCGAGCA CAGAGCCTCG CCTTTGCCGA TCCGCCGCCC GTCCACACCC 000070
000071 GCCGCCAGCT CACCATGGAT GATGATATCG CCGCGCTCGT CGTCGACAAC GGCTCCGGCA TGTGCAAGGC 000140
000141 CGGCTTCGCG GGCGACGATG CCCCCCGGGC CGTCTTCCCC TCCATCGTGG GGCGCCCCAG GCACCAGGGC 000210
000211 GTGATGGTGG GCATGGGTCA GAAGGATTCC TATGTGGGCG ACGAGGCCCA GAGCAAGAGA GGCATCCTCA 000280
000281 CCCTGAAGTA CCCCATCGAG CACGGCATCG TCACCAACTG GGACGACATG GAGAAAATCT GGCACCACAC 000350
000351 CTTCTACAAT GAGCTGCGTG TGGCTCCCGA GGAGCACCCC GTGCTGCTGA CCGAGGCCCC CCTGAACCCC 000420
000421 AAGGCCAACC GCGAGAAGAT GACCCAGATC ATGTTTGAGA CCTTCAACAC CCCAGCCATG TACGTTGCTA 000490
000491 TCCAGGCTGT GCTATCCCTG TACGCCTCTG GCCGTACCAC TGGCATCGTG ATGGACTCCG GTGACGGGGT 000560
000561 CACCCACACT GTGCCCATCT ACGAGGGGTA TGCCCTCCCC CATGCCATCC TGCGTCTGGA CCTGGCTGGC 000630
000631 CGGGACCTGA CTGACTACCT CATGAAGATC CTCACCGAGC GCGGCTACAG CTTCACCACC ACGGCCGAGC 000700
000701 GGGAAATCGT GCGTGACATT AAGGAGAAGC TGTGCTACGT CGCCCTGGAC TTCGAGCAAG AGATGGCCAC 000770
000771 GGCTGCTTCC AGCTCCTCCC TGGAGAAGAG CTACGAGCTG CCTGACGGCC AGGTCATCAC CATTGGCAAT 000840
000841 GAGCGGTTCC GCTGCCCTGA GGCACTCTTC CAGCCTTCCT TCCTGGGCAT GGAGTCCTGT GGCATCCACG 000910
000911 AAACTACCTT CAACTCCATC ATGAAGTGTG ACGTGGACAT CCGCAAAGAC CTGTACGCCA ACACAGTGCT 000980
000981 GTCTGGCGGC ACCACCATGT ACCCTGGCAT TGCCGACAGG ATGCAGAAGG AGATCACTGC CCTGGCACCC 001050
001051 AGCACAATGA AGATCAAGAT CATTGCTCCT CCTGAGCGCA AGTACTCCGT GTGGATCGGC GGCTCCATCC 001120
001121 TGGCCTCGCT GTCCACCTTC CAGCAGATGT GGATCAGCAA GCAGGAGTAT GACGAGTCCG GCCCCTCCAT 001190
001191 CGTCCACCGC AAATGCTTCT AGGCGGACTA TGACTTAGTT GCGTTACACC CTTTCTTGAC AAAACCTAAC 001260
001261 TTGCGCAGAA AACAAGATGA GATTGGCATG GCTTTATTTG TTTTTTTTGT TTTGTTTTGG TTTTTTTTTT 001330
001331 TTTTTTGGCT TGACTCAGGA TTTAAAAACT GGAACGGTGA AGGTGACAGC AGTCGGTTGG AGCGAGCATC 001400
001401 CCCCAAAGTT CACAATGTGG CCGAGGACTT TGATTGCACA TTGTTGTTTT TTTAATAGTC ATTCCAAATA 001470
001471 TGAGATGCGT TGTTACAGGA AGTCCCTTGC CATCCTAAAA GCCACCCCAC TTCTCTCTAA GGAGAATGGC 001540
001541 CCAGTCCTCT CCCAAGTCCA CACAGGGGAG GTGATAGCAT TGCTTTCGTG TAAATTATGT AATGCAAAAT 001610
001611 TTTTTTAATC TTCGCCTTAA TACTTTTTTA TTTTGTTTTA TTTTGAATGA TGAGCCTTCG TGCCCCCCCT 001680
001681 TCCCCCTTTT TTGTCCCCCA ACTTGAGATG TATGAAGGCT TTTGGTCTCC CTGGGAGTGG GTGGAGGCAG 001750
001751 CCAGGGCTTA CCTGTACACT GACTTGAGAC CAGTTGAATA AAAGTGCACA CCTTAAAAAT GAAAAAAAAA 001820
001821 AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AA

Conserved Domains

The Conserved domains of Homo sapiens ACT is displayed as example.

ACT.png

External Links