Tetranychus urticae

From ICG
Jump to navigation Jump to search

Description

REFqPCR2015023-1.jpg
  • The two-spotted spider mite, Tetranychus urticae Koch, is one of the most important pest species worldwide. Considered as the most polyphagous species within the family of Tetrany-chidae, T. urticae can infest nearly 800 plant species, including peppers, tomatoes, potatoes, beans, maize, strawberries, and ornamental plants such as roses.
  • T. urticae lays its egg on the leaf, damages host plants by sucking cell contents from the leaf, and leaves tiny pale spots or scars where the green epidermal cells have been destroyed. Although the individual lesions are small in size, attacks by hundreds and thousands of spider mites can significantly reduce the photosynthetic capability of plants [5]. The control of T. urticae has traditionally relied on synthetic insecticides and acaricides.
  • The two‐spotted spider mite, Tetranychus urticae, and the carmine spider mite, Tetranychus cinnabarinus, are both economically important species of the genus Tetranychus, which belongs to the class Arachnida, infraclass Acari, order Prostigmata, and family Tetranychidae. As sibling species, T. urticae and T. cinnabarinus can seriously damage fruit trees, vegetables, ornamentals, and weeds throughout the world. [1] [2].

Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PRL13[1] ribosomal protein L13
  • Univeral reference gene
JN881328
  • F:GCTCACAGCCTATGAAGGTATT
  • R:GCTCACAGCCTATGAAGGTATT
90 55 SYBR
v-ATPase[1] vacuolar-type H+-ATPase
  • Univeral reference gene
DQ988698
  • F:CCCGAAGAGATGATCCAAACTG
  • R:CCCGAAGAGATGATCCAAACTG
99 55 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: S.K. Bhure
  • Email: sdbhure@rediffmail.com
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Lu W, Wang M, Xu Z, et al. (2017) Adaptation of acaricide stress facilitates Tetranychus urticae expanding against Tetranychus cinnabarinus in China. Ecol Evol 7, 1233-1249.
  2. Yang C, Pan H, Liu Y, Zhou X (2015) Stably expressed housekeeping genes across developmental stages in the two-spotted spider mite, Tetranychus urticae. PLoS One 10, e0120833.