Difference between revisions of "Tribolium castaneum"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
  
[[File:Tribolium castaneum-1.jpg|right|327px|]]
+
[[File:Tribolium castaneum.png|right|200px|]]
 
* Tribolium castaneum is an important model and pest beetle species.The red flour beetle Tribolium castaneum has become an important insect model organism in developmental genetics and evolutionary developmental biology.  It has become a powerful model organism also for studies of insect immunity, with a fully-sequenced genome<ref name="ref1"/> <ref name="ref2"/> .
 
* Tribolium castaneum is an important model and pest beetle species.The red flour beetle Tribolium castaneum has become an important insect model organism in developmental genetics and evolutionary developmental biology.  It has become a powerful model organism also for studies of insect immunity, with a fully-sequenced genome<ref name="ref1"/> <ref name="ref2"/> .
 
* <font color=blue>'''Common Name:'''</font> '''Red flour beetle'''
 
* <font color=blue>'''Common Name:'''</font> '''Red flour beetle'''

Revision as of 15:36, 26 June 2017

Description

Tribolium castaneum.png
  • Tribolium castaneum is an important model and pest beetle species.The red flour beetle Tribolium castaneum has become an important insect model organism in developmental genetics and evolutionary developmental biology. It has become a powerful model organism also for studies of insect immunity, with a fully-sequenced genome[1] [2] .
  • Common Name: Red flour beetle
  • NCBI Taxonomy

Fungal Challenge

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPS18[1] Ribosomal protein S18
  • Exposed to Beauveria bassiana
XM_968539
  • F:CGAAGAGGTCGAGAAAATCG
  • R:CGTGGTCTTGGTGTGTTGAC
NA 55 SYBR
RPS3[1] Ribosomal protein S3
  • Exposed to Beauveria bassiana
XM_965494
  • F:ACCTCGATACACCATAGCAAGC
  • R:ACCGTCGTATTCGTGAATTGAC
NA 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Brenda Oppert
  • Email: jeff.lord@ars.usda.gov
  • Institution: USDA-ARS, Grain Marketing and Production Research Center, 1515 College Avenue, Manhattan, KS 66502, USA

Citation Statistics

Cited by 71 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Lord J C, Hartzer K, Toutges M, et al. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge[J]. Journal of microbiological methods, 2010, 80(2): 219-221.
  2. Strobl F, Klees S, Stelzer EHK.J Vis Exp. 2017 Apr 28;(122). doi: 10.3791/55629.PMID: 28518097.