Difference between revisions of "Tribolium castaneum"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''''Fungal Challenge'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! st...")
 
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
 +
[[File:Tribolium castaneum-1.jpg|right|327px|]]
 +
* Tribolium castaneum is an important model and pest beetle species.The red flour beetle Tribolium castaneum has become an important insect model organism in developmental genetics and evolutionary developmental biology.  It has become a powerful model organism also for studies of insect immunity, with a fully-sequenced genome<ref name="ref1"/> <ref name="ref2"/> .
 
=='''''Fungal Challenge'''''==
 
=='''''Fungal Challenge'''''==
 
===Reference Genes===
 
===Reference Genes===
Line 50: Line 53:
 
<ref name="ref1">
 
<ref name="ref1">
 
Lord J C, Hartzer K, Toutges M, et al. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge[J]. Journal of microbiological methods, 2010, 80(2): 219-221.
 
Lord J C, Hartzer K, Toutges M, et al. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge[J]. Journal of microbiological methods, 2010, 80(2): 219-221.
 +
</ref>
 +
<ref name="ref2">
 +
Strobl F, Klees S, Stelzer EHK.J Vis Exp. 2017 Apr 28;(122). doi: 10.3791/55629.PMID: 28518097
 
</ref>
 
</ref>
 
</references>
 
</references>

Revision as of 13:25, 16 June 2017

Description

Tribolium castaneum-1.jpg
  • Tribolium castaneum is an important model and pest beetle species.The red flour beetle Tribolium castaneum has become an important insect model organism in developmental genetics and evolutionary developmental biology. It has become a powerful model organism also for studies of insect immunity, with a fully-sequenced genome[1] [2] .

Fungal Challenge

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPS18[1] Ribosomal protein S18

exposed to Beauveria bassiana

XM_968539
  • F:CGAAGAGGTCGAGAAAATCG
  • R:CGTGGTCTTGGTGTGTTGAC
NA 55 SYBR
RPS3[1] Ribosomal protein S3

exposed to Beauveria bassiana

XM_965494
  • F:ACCTCGATACACCATAGCAAGC
  • R:ACCGTCGTATTCGTGAATTGAC
NA 55 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Brenda Oppert
  • Email: jeff.lord@ars.usda.gov
  • Institution: USDA-ARS, Grain Marketing and Production Research Center, 1515 College Avenue, Manhattan, KS 66502, USA

References

  1. 1.0 1.1 1.2 Lord J C, Hartzer K, Toutges M, et al. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge[J]. Journal of microbiological methods, 2010, 80(2): 219-221.
  2. Strobl F, Klees S, Stelzer EHK.J Vis Exp. 2017 Apr 28;(122). doi: 10.3791/55629.PMID: 28518097