Tribolium castaneum

From ICG
Revision as of 12:13, 16 June 2017 by Xysj2012 (talk | contribs) (Created page with "=='''Description'''== =='''''Fungal Challenge'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! st...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Fungal Challenge

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPS18[1] Ribosomal protein S18

exposed to Beauveria bassiana

XM_968539
  • F:CGAAGAGGTCGAGAAAATCG
  • R:CGTGGTCTTGGTGTGTTGAC
NA 55 SYBR
RPS3[1] Ribosomal protein S3

exposed to Beauveria bassiana

XM_965494
  • F:ACCTCGATACACCATAGCAAGC
  • R:ACCGTCGTATTCGTGAATTGAC
NA 55 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Brenda Oppert
  • Email: jeff.lord@ars.usda.gov
  • Institution: USDA-ARS, Grain Marketing and Production Research Center, 1515 College Avenue, Manhattan, KS 66502, USA

References

  1. 1.0 1.1 Lord J C, Hartzer K, Toutges M, et al. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge[J]. Journal of microbiological methods, 2010, 80(2): 219-221.