Tribolium castaneum

From ICG
Revision as of 13:25, 16 June 2017 by ICG Expert4 (talk | contribs)
Jump to navigation Jump to search

Description

Tribolium castaneum-1.jpg
  • Tribolium castaneum is an important model and pest beetle species.The red flour beetle Tribolium castaneum has become an important insect model organism in developmental genetics and evolutionary developmental biology. It has become a powerful model organism also for studies of insect immunity, with a fully-sequenced genome[1] [2] .

Fungal Challenge

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPS18[1] Ribosomal protein S18

exposed to Beauveria bassiana

XM_968539
  • F:CGAAGAGGTCGAGAAAATCG
  • R:CGTGGTCTTGGTGTGTTGAC
NA 55 SYBR
RPS3[1] Ribosomal protein S3

exposed to Beauveria bassiana

XM_965494
  • F:ACCTCGATACACCATAGCAAGC
  • R:ACCGTCGTATTCGTGAATTGAC
NA 55 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Brenda Oppert
  • Email: jeff.lord@ars.usda.gov
  • Institution: USDA-ARS, Grain Marketing and Production Research Center, 1515 College Avenue, Manhattan, KS 66502, USA

References

  1. 1.0 1.1 1.2 Lord J C, Hartzer K, Toutges M, et al. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge[J]. Journal of microbiological methods, 2010, 80(2): 219-221.
  2. Strobl F, Klees S, Stelzer EHK.J Vis Exp. 2017 Apr 28;(122). doi: 10.3791/55629.PMID: 28518097