Difference between revisions of "Trifolium pratense"

From ICG
Jump to navigation Jump to search
Line 54: Line 54:
 
*'''Email''': mehdikhanloo@yahoo.com
 
*'''Email''': mehdikhanloo@yahoo.com
 
*'''Institution''': Department of Plant Production, Ghent University, Coupure Links 653, 9000 Ghent, Belgium
 
*'''Institution''': Department of Plant Production, Ghent University, Coupure Links 653, 9000 Ghent, Belgium
 +
===Citation Statistics===
 +
Cited by '''28''' (Based on Google Scholar [2017-06-01])
  
 
=='''References'''==
 
=='''References'''==

Revision as of 09:41, 19 June 2017

Description

Trifolium pratense-1.jpg
  • Red clover (Trifolium pratense L.) is an important forage legume widely cultivated in most temperate regions because of its characteristics of high seedling vigor, rapid growth, and tolerance to acidic and humid conditions.
  • It is also used as a green manure crop because of its high nutrient content resulting partly from symbiosis with nitrogen fixing bacteria of the genus Rhizobium. Red clover has a diploid genome (2n = 2x = 14), with a DNA content of 0.97 pg/2C,7 which is slightly larger than that of rice[1] [2].

Different Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
YLS8[1] yellow-leaf-specific protein 8
  • Universal reference gene
BB917276
  • F:CCCTTCCTTGCACCTCTGTA
  • R:CACCGGAAACAACAACAAGA
93 60 SYBR
UBC2[1] ubiquitin-conjugating enzyme E2
  • Universal reference gene
BB916552
  • F:TCCAAACCCAAACTCTCCAG
  • R:CTGCTCAACAATCTCGCGTA
97 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Khosro Mehdi Khanlou
  • Email: mehdikhanloo@yahoo.com
  • Institution: Department of Plant Production, Ghent University, Coupure Links 653, 9000 Ghent, Belgium

Citation Statistics

Cited by 28 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Khanlou K M, Van Bockstaele E. A critique of widely used normalization software tools and an alternative method to identify reliable reference genes in red clover (Trifolium pratense L.)[J]. Planta, 2012, 236(5): 1381-1393.
  2. Sato S, Isobe S, Asamizu E, et al. Comprehensive structural analysis of the genome of red clover (Trifolium pratense L.)[J]. DNA research, 2005, 12(5): 301-364.