Difference between revisions of "Triticum aestivum"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== right|327px| * Wheat (Triticum aestivum) is the dominant crop in temperate countries being used for human food and livestock...")
 
Line 90: Line 90:
 
*'''Email''': jjscholtz@gmail.com
 
*'''Email''': jjscholtz@gmail.com
 
*'''Institution''':  Department Plant Sciences, University of the Free State, Nelson Mandela Road, Bloemfontein 9301, South Africa
 
*'''Institution''':  Department Plant Sciences, University of the Free State, Nelson Mandela Road, Bloemfontein 9301, South Africa
 +
===Citation Statistics===
 +
Cited by '''17''' (Based on Google Scholar [2017-06-16])
  
 
=='''References'''==
 
=='''References'''==
Line 106: Line 108:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
[[Category:Plants]]

Revision as of 08:42, 16 June 2017

Description

Triticum aestivum-1.jpg
  • Wheat (Triticum aestivum) is the dominant crop in temperate countries being used for human food and livestock feed. Wheat is counted among the ‘big three’ cereal crops, with over 600 million tonnes being harvested annually.
  • Wheat is unrivalled in its range of cultivation, from 67º N in Scandinavia and Russia to 45º S in Argentina, including elevated regions in the tropics and sub-tropics.The first cultivation of wheat occurred about 10 000 years ago. These earliest cultivated forms were diploid (genome AA) (einkorn) and tetraploid (genome AABB) (emmer) wheats and their genetic relationships indicate that they originated from the south-eastern part of Turkey.
  • Cultivation spread to the Near East by about 9000 years ago when hexaploid bread wheat made its first appearance. Currently, about 95% of the wheat grown worldwide is hexaploid bread wheat (Triticum aestivum), with most of the remaining 5% being tetraploid durum wheat. Wheat contributes essential amino acids, minerals, and vitamins, and beneficial phytochemicals and dietary fibre components to the human diet, and these are particularly enriched in whole-grain products[1] [2] [3] [4].

Rust Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ARF[1] ADP-ribosylation factor
  • P.triticina-infected wheat
AB050957
  • F:GCTCTCCAACAACATTGCCAAC
  • R:GCTTCTGCCTGTCACATACGC
165 60 SYBR
RLI[1] RNase L inhibitor-like protein
  • P.triticina-infected wheat
  • P.striiformis-infected wheat
AK331207
  • F:CGATTCAGAGCAGCGTATTGTTG
  • R:AGTTGGTCGGGTCTCTTCTAAATG
242 60 SYBR
CDC[1] Cell division control protein
  • P.graminis f.sp.tritici-infected wheat
  • P.striiformis-infected wheat
EU267938
  • F:CAAATACGCCATCAGGGAGAACATC
  • R:CGCTGCCGAAACCACGAGAC
227 60 SYBR
18S[1] 18S rRNA
  • P.graminis f.sp.tritici-infected wheat
AH001810
  • F:GTGACGGGTGACGGAGAATT
  • R:GACACTAATGCGCCCGGTAT
151 60 SYBR
TUBB[1] b-Tubulin
  • P.graminis f.sp.tritici-infected wheat
U76897
  • F:CAAGGAGGTGGACGAGCAGATG
  • R:GACTTGACGTTGTTGGGGATCCA
84 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jakobus J. Scholtz
  • Email: jjscholtz@gmail.com
  • Institution: Department Plant Sciences, University of the Free State, Nelson Mandela Road, Bloemfontein 9301, South Africa

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Scholtz J J, Visser B. Reference gene selection for qPCR gene expression analysis of rust-infected wheat[J]. Physiological and molecular plant pathology, 2013, 81: 22-25.
  2. Shewry, Peter R (2009), "Wheat", Journal of Experimental Botany, 60 (6): 1537–1553, doi:10.1093/jxb/erp058, PMID 19386614.
  3. Feldman M. Smartt J, Simmonds NW. Wheats, Evolution of crop plants , 1995Harlow, UKLongman Scientific and Technical(pg. 185-192).
  4. Heun M, Schäfer-Pregl R, Klawan D, Castagna R, Accerbi M, Borghi B, Salamini F. Site of einkorn wheat domestication identified by DNA fingerprinting, Science , 1997, vol. 278 (pg. 1312-1314).