Difference between revisions of "Triticum aestivum"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) (Created page with "==Description== right|327px| * Wheat (Triticum aestivum) is the dominant crop in temperate countries being used for human food and livestock...") |
Niu Guangyi (talk | contribs) |
||
(38 intermediate revisions by 7 users not shown) | |||
Line 1: | Line 1: | ||
==Description== | ==Description== | ||
− | + | [[File:Triticum aestivum.png|right|200px|link=Triticum aestivum]] | |
− | [[File:Triticum aestivum | + | *'''''Triticum aestivum''''' is the dominant crop in temperate countries being used for human food and livestock feed. Wheat is counted among the ‘big three’ cereal crops, with over 600 million tonnes being harvested annually. Wheat is unrivalled in its range of cultivation, from 67º N in Scandinavia and Russia to 45º S in Argentina, including elevated regions in the tropics and sub-tropics. The genetic relationships indicate that they originated from the south-eastern part of Turkey. Wheat contributes essential amino acids, minerals, and vitamins, and beneficial phytochemicals and dietary fibre components to the human diet<ref name="ref1"/><ref name="ref2"/><ref name="ref3"/><ref name="ref4"/>. |
− | * | + | * <font color=blue>'''Common Name:'''</font> '''Wheat''' |
− | + | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4565 <font color=blue>'''NCBI Taxonomy'''</font>] | |
− | |||
=='''''Rust Infection'''''== | =='''''Rust Infection'''''== | ||
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 14: | Line 13: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 70: | Line 69: | ||
|- | |- | ||
|align="center"| TUBB<ref name="ref1"/> | |align="center"| TUBB<ref name="ref1"/> | ||
− | |align="center"| | + | |align="center"| B-Tubulin |
| | | | ||
* P.graminis f.sp.tritici-infected wheat | * P.graminis f.sp.tritici-infected wheat | ||
Line 82: | Line 81: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
*mRNA | *mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 90: | Line 90: | ||
*'''Email''': jjscholtz@gmail.com | *'''Email''': jjscholtz@gmail.com | ||
*'''Institution''': Department Plant Sciences, University of the Free State, Nelson Mandela Road, Bloemfontein 9301, South Africa | *'''Institution''': Department Plant Sciences, University of the Free State, Nelson Mandela Road, Bloemfontein 9301, South Africa | ||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=17072642987301601146&as_sdt=2005&sciodt=0,5&hl=en '''17'''] (Based on Google Scholar [2017-09-01]) | ||
+ | |||
+ | =='''''Biotic & Abiotic Stress Treatments'''''== | ||
+ | ===Reference Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primers (5'-3')<br>[Forward/Reverse] | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| mi167 <ref name="ref2"/> | ||
+ | |align="center"| Mi167 | ||
+ | | | ||
+ | * Universal reference gene | ||
+ | |align="center"| [http://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0006174 '''MI0006174'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CGCGATGAAGCTGCCAGCAT | ||
+ | * R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGATC | ||
+ | |align="center"| NA | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| mi159<ref name="ref2"/> | ||
+ | |align="center"| Mi159 | ||
+ | | | ||
+ | * Universal reference gene | ||
+ | |align="center"| [http://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0006170 '''MI0006170'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CGCGCTTTGGATTGAAGGGA | ||
+ | * R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGAGC | ||
+ | |align="center"| NA | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | |||
+ | ===Molecular types=== | ||
+ | * miRNA | ||
+ | |||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': Zhensheng Kang | ||
+ | *'''Email''': kangzs@nwsuaf.edu.cn | ||
+ | *'''Institution''': College of Plant Protection, Northwest A & F University, 712100, Yangling, Shaanxi, People’s Republic of China | ||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=2660361434414628076&as_sdt=2005&sciodt=0,5&hl=en '''44'''] (Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
Line 97: | Line 150: | ||
</ref> | </ref> | ||
<ref name="ref2"> | <ref name="ref2"> | ||
− | + | Feng H, Huang X, Zhang Q, et al. Selection of suitable inner reference genes for relative quantification expression of microRNA in wheat[J]. Plant Physiology and Biochemistry, 2012, 51: 116-122. | |
</ref> | </ref> | ||
<ref name="ref3"> | <ref name="ref3"> | ||
Line 106: | Line 159: | ||
</ref> | </ref> | ||
</references> | </references> | ||
+ | |||
+ | =='''Categories'''== | ||
+ | [[Category:Plants]] [[Category:non-coding RNA]] [[Category:mRNA]] [[Category:SYBR]] | ||
+ | [[Category:18S rRNA]] [[Category:ARF]] [[Category:CDC]] [[Category:Small RNAs]] [[Category:RLI]] [[Category:Tubulin]] | ||
+ | [[Category:Biotic Stress]] [[Category:Fungal infection]] [[Category:Abiotic Stress]] [[Category:Pathological conditions]] | ||
+ | [[Category:geNorm]] | ||
+ | [[Category:NormFinder]] |
Latest revision as of 05:22, 1 September 2017
Contents
Description
- Triticum aestivum is the dominant crop in temperate countries being used for human food and livestock feed. Wheat is counted among the ‘big three’ cereal crops, with over 600 million tonnes being harvested annually. Wheat is unrivalled in its range of cultivation, from 67º N in Scandinavia and Russia to 45º S in Argentina, including elevated regions in the tropics and sub-tropics. The genetic relationships indicate that they originated from the south-eastern part of Turkey. Wheat contributes essential amino acids, minerals, and vitamins, and beneficial phytochemicals and dietary fibre components to the human diet[1][2][3][4].
- Common Name: Wheat
- NCBI Taxonomy
Rust Infection
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
ARF[1] | ADP-ribosylation factor |
|
AB050957 |
|
165 | 60 | SYBR |
RLI[1] | RNase L inhibitor-like protein |
|
AK331207 |
|
242 | 60 | SYBR |
CDC[1] | Cell division control protein |
|
EU267938 |
|
227 | 60 | SYBR |
18S[1] | 18S rRNA |
|
AH001810 |
|
151 | 60 | SYBR |
TUBB[1] | B-Tubulin |
|
U76897 |
|
84 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Jakobus J. Scholtz
- Email: jjscholtz@gmail.com
- Institution: Department Plant Sciences, University of the Free State, Nelson Mandela Road, Bloemfontein 9301, South Africa
Citation Statistics
Cited by 17 (Based on Google Scholar [2017-09-01])
Biotic & Abiotic Stress Treatments
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
mi167 [2] | Mi167 |
|
MI0006174 |
|
NA | 60 | SYBR |
mi159[2] | Mi159 |
|
MI0006170 |
|
NA | 60 | SYBR |
Molecular types
- miRNA
Evaluation Methods
Contact
- Name: Zhensheng Kang
- Email: kangzs@nwsuaf.edu.cn
- Institution: College of Plant Protection, Northwest A & F University, 712100, Yangling, Shaanxi, People’s Republic of China
Citation Statistics
Cited by 44 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Scholtz J J, Visser B. Reference gene selection for qPCR gene expression analysis of rust-infected wheat[J]. Physiological and molecular plant pathology, 2013, 81: 22-25.
- ↑ 2.0 2.1 2.2 Feng H, Huang X, Zhang Q, et al. Selection of suitable inner reference genes for relative quantification expression of microRNA in wheat[J]. Plant Physiology and Biochemistry, 2012, 51: 116-122.
- ↑ Feldman M. Smartt J, Simmonds NW. Wheats, Evolution of crop plants , 1995Harlow, UKLongman Scientific and Technical(pg. 185-192).
- ↑ Heun M, Schäfer-Pregl R, Klawan D, Castagna R, Accerbi M, Borghi B, Salamini F. Site of einkorn wheat domestication identified by DNA fingerprinting, Science , 1997, vol. 278 (pg. 1312-1314).