Difference between revisions of "Triticum aestivum"

From ICG
Jump to navigation Jump to search
 
(30 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
 
+
[[File:Triticum aestivum.png|right|200px|link=Triticum aestivum]]
[[File:Triticum aestivum-1.jpg|right|327px|]]
+
*'''''Triticum aestivum''''' is the dominant crop in temperate countries being used for human food and livestock feed. Wheat is counted among the ‘big three’ cereal crops, with over 600 million tonnes being harvested annually. Wheat is unrivalled in its range of cultivation, from 67º N in Scandinavia and Russia to 45º S in Argentina, including elevated regions in the tropics and sub-tropics. The genetic relationships indicate that they originated from the south-eastern part of Turkey. Wheat contributes essential amino acids, minerals, and vitamins, and beneficial phytochemicals and dietary fibre components to the human diet<ref name="ref1"/><ref name="ref2"/><ref name="ref3"/><ref name="ref4"/>.
* Wheat (Triticum aestivum) is the dominant crop in temperate countries being used for human food and livestock feed. Wheat is counted among the ‘big three’ cereal crops, with over 600 million tonnes being harvested annually.
+
* <font color=blue>'''Common Name:'''</font> '''Wheat'''
* Wheat is unrivalled in its range of cultivation, from 67º N in Scandinavia and Russia to 45º S in Argentina, including elevated regions in the tropics and sub-tropics.The first cultivation of wheat occurred about 10 000 years ago. These earliest cultivated forms were diploid (genome AA) (einkorn) and tetraploid (genome AABB) (emmer) wheats and their genetic relationships indicate that they originated from the south-eastern part of Turkey.  
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4565 <font color=blue>'''NCBI Taxonomy'''</font>]
* Cultivation spread to the Near East by about 9000 years ago when hexaploid bread wheat made its first appearance. Currently, about 95% of the wheat grown worldwide is hexaploid bread wheat (Triticum aestivum), with most of the remaining 5% being tetraploid durum wheat. Wheat contributes essential amino acids, minerals, and vitamins, and beneficial phytochemicals and dietary fibre components to the human diet, and these are particularly enriched in whole-grain products<ref name="ref1"/> <ref name="ref2"/> <ref name="ref3"/> <ref name="ref4"/>.
 
  
 
=='''''Rust Infection'''''==
 
=='''''Rust Infection'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 14: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 70: Line 69:
 
|-
 
|-
 
|align="center"| TUBB<ref name="ref1"/>
 
|align="center"| TUBB<ref name="ref1"/>
|align="center"| b-Tubulin
+
|align="center"| B-Tubulin
 
|
 
|
 
* P.graminis f.sp.tritici-infected wheat  
 
* P.graminis f.sp.tritici-infected wheat  
Line 82: Line 81:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 91: Line 91:
 
*'''Institution''':  Department Plant Sciences, University of the Free State, Nelson Mandela Road, Bloemfontein 9301, South Africa
 
*'''Institution''':  Department Plant Sciences, University of the Free State, Nelson Mandela Road, Bloemfontein 9301, South Africa
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''17''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=17072642987301601146&as_sdt=2005&sciodt=0,5&hl=en '''17'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Biotic & Abiotic Stress Treatments'''''==
 
=='''''Biotic & Abiotic Stress Treatments'''''==
Line 101: Line 101:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 107: Line 107:
 
|-
 
|-
 
|align="center"| mi167 <ref name="ref2"/>
 
|align="center"| mi167 <ref name="ref2"/>
|align="center"| mi167
+
|align="center"| Mi167
 
|
 
|
 
* Universal reference gene
 
* Universal reference gene
Line 119: Line 119:
 
|-
 
|-
 
|align="center"| mi159<ref name="ref2"/>
 
|align="center"| mi159<ref name="ref2"/>
|align="center"| mi159
+
|align="center"| Mi159
 
|
 
|
 
* Universal reference gene
 
* Universal reference gene
Line 131: Line 131:
 
|}
 
|}
  
===Moleculer types===
+
===Molecular types===
 
* miRNA
 
* miRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 139: Line 140:
 
*'''Name''': Zhensheng Kang
 
*'''Name''': Zhensheng Kang
 
*'''Email''': kangzs@nwsuaf.edu.cn
 
*'''Email''': kangzs@nwsuaf.edu.cn
*'''Institute''': College of Plant Protection, Northwest A & F University, 712100, Yangling, Shaanxi, People’s Republic of China
+
*'''Institution''': College of Plant Protection, Northwest A & F University, 712100, Yangling, Shaanxi, People’s Republic of China
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=2660361434414628076&as_sdt=2005&sciodt=0,5&hl=en '''44'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 157: Line 160:
 
</references>
 
</references>
  
[[Category:Plants]] [[Category:miRNA]] [[Category:mRNA]]
+
=='''Categories'''==
 +
[[Category:Plants]] [[Category:non-coding RNA]] [[Category:mRNA]] [[Category:SYBR]]
 +
[[Category:18S rRNA]] [[Category:ARF]] [[Category:CDC]] [[Category:Small RNAs]] [[Category:RLI]] [[Category:Tubulin]]
 +
[[Category:Biotic Stress]]  [[Category:Fungal infection]]  [[Category:Abiotic Stress]]  [[Category:Pathological conditions]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 05:22, 1 September 2017

Description

Triticum aestivum.png
  • Triticum aestivum is the dominant crop in temperate countries being used for human food and livestock feed. Wheat is counted among the ‘big three’ cereal crops, with over 600 million tonnes being harvested annually. Wheat is unrivalled in its range of cultivation, from 67º N in Scandinavia and Russia to 45º S in Argentina, including elevated regions in the tropics and sub-tropics. The genetic relationships indicate that they originated from the south-eastern part of Turkey. Wheat contributes essential amino acids, minerals, and vitamins, and beneficial phytochemicals and dietary fibre components to the human diet[1][2][3][4].
  • Common Name: Wheat
  • NCBI Taxonomy

Rust Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ARF[1] ADP-ribosylation factor
  • P.triticina-infected wheat
AB050957
  • F:GCTCTCCAACAACATTGCCAAC
  • R:GCTTCTGCCTGTCACATACGC
165 60 SYBR
RLI[1] RNase L inhibitor-like protein
  • P.triticina-infected wheat
  • P.striiformis-infected wheat
AK331207
  • F:CGATTCAGAGCAGCGTATTGTTG
  • R:AGTTGGTCGGGTCTCTTCTAAATG
242 60 SYBR
CDC[1] Cell division control protein
  • P.graminis f.sp.tritici-infected wheat
  • P.striiformis-infected wheat
EU267938
  • F:CAAATACGCCATCAGGGAGAACATC
  • R:CGCTGCCGAAACCACGAGAC
227 60 SYBR
18S[1] 18S rRNA
  • P.graminis f.sp.tritici-infected wheat
AH001810
  • F:GTGACGGGTGACGGAGAATT
  • R:GACACTAATGCGCCCGGTAT
151 60 SYBR
TUBB[1] B-Tubulin
  • P.graminis f.sp.tritici-infected wheat
U76897
  • F:CAAGGAGGTGGACGAGCAGATG
  • R:GACTTGACGTTGTTGGGGATCCA
84 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jakobus J. Scholtz
  • Email: jjscholtz@gmail.com
  • Institution: Department Plant Sciences, University of the Free State, Nelson Mandela Road, Bloemfontein 9301, South Africa

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-09-01])

Biotic & Abiotic Stress Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
mi167 [2] Mi167
  • Universal reference gene
MI0006174
  • F:CGCGATGAAGCTGCCAGCAT
  • R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGATC
NA 60 SYBR
mi159[2] Mi159
  • Universal reference gene
MI0006170
  • F:CGCGCTTTGGATTGAAGGGA
  • R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGAGC
NA 60 SYBR

Molecular types

  • miRNA

Evaluation Methods

Contact

  • Name: Zhensheng Kang
  • Email: kangzs@nwsuaf.edu.cn
  • Institution: College of Plant Protection, Northwest A & F University, 712100, Yangling, Shaanxi, People’s Republic of China

Citation Statistics

Cited by 44 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Scholtz J J, Visser B. Reference gene selection for qPCR gene expression analysis of rust-infected wheat[J]. Physiological and molecular plant pathology, 2013, 81: 22-25.
  2. 2.0 2.1 2.2 Feng H, Huang X, Zhang Q, et al. Selection of suitable inner reference genes for relative quantification expression of microRNA in wheat[J]. Plant Physiology and Biochemistry, 2012, 51: 116-122.
  3. Feldman M. Smartt J, Simmonds NW. Wheats, Evolution of crop plants , 1995Harlow, UKLongman Scientific and Technical(pg. 185-192).
  4. Heun M, Schäfer-Pregl R, Klawan D, Castagna R, Accerbi M, Borghi B, Salamini F. Site of einkorn wheat domestication identified by DNA fingerprinting, Science , 1997, vol. 278 (pg. 1312-1314).

Categories