Difference between revisions of "Tuber melanosporum"

From ICG
Jump to navigation Jump to search
Line 83: Line 83:
  
 
[[Category:Fungi]]
 
[[Category:Fungi]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 07:41, 19 June 2017

Description

REFqPCR2015001-1.jpg
  • The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres.
  • The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis, called ectomycorrhiza, with roots of trees and shrubs such as oaks, pine and hazelnut trees. The ectomycorrhizal symbiosis is indispensable to the truffle life cycle, that results in the fruit bodies ripening in autumn and winter. Several members of the truffle genus Tuber are highly praised and priced gourmet food, and their aroma and taste are known worldwide (Rubini et al., 2007). Some of the most precious edible fungi are found amongst scented truffles: Tuber magnatum Pico – the Italian white truffle and T. melanosporum the Périgord black truffle. The publication of the T. melanosporum genome has given researchers a unique opportunity to learn more about the biology of the fungus.
  • Tuber melanosporum, known as the “black”, “winter” or “Périgord” truffle and commonly referred to as the ‘‘black diamond of cuisine”, is one of the most highly appreciated truffle species. Due to its intense and complex aroma, T. melanosporum is considered the queen of truffles, and is one of the most highly prized foods worldwide. [1] [2].

Different Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF1A[1] Elongation factor 1-alpha
  • Universal reference gene
GSTUMT00000021001
  • F:AAGGGTGCCGAGTCTTTCAA
  • R:AAGGGTGCCGAGTCTTTCAA
100 60 SYBR
G6PD[1] Glucose-6-phosphate dehydrogenase
  • Universal reference gene
GSTUMT00008696001
  • F:CGCGATGAGAAGGTCAGAGTT
  • R:CGCGATGAGAAGGTCAGAGTT
100 60 SYBR
18S[1] 18S ribosomal RNA
  • Universal reference gene
AM748736.1
  • F:CGCGATGAGAAGGTCAGAGTT
  • R:CGCGATGAGAAGGTCAGAGTT
100 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Osvaldo Zarivi
  • Email: osvaldo.zarivi@univaq.it
  • Institution: Department of Life, Health and Environmental Sciences, University of L'Aquila, 67100 L'Aquila, Italy

Citation Statistics

Cited by 0 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Campo E, Marco P, Oria R, Blanco D, Venturini ME (2017) What is the best method for preserving the genuine black truffle (Tuber melanosporum) aroma? An olfactometric and sensory approach. LWT - Food Science and Technology 80, 84-91.
  2. Zarivi O, Cesare P, Ragnelli AM, et al. (2015) Validation of reference genes for quantitative real-time PCR in Perigord black truffle (Tuber melanosporum) developmental stages. Phytochemistry 116, 78-86.