Difference between revisions of "Ulva linza"

From ICG
Jump to navigation Jump to search
 
(11 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
[[File:Ulva linza.png|right|200px|link=Ulva linza]]
[[File:Ulva linza-1.jpg|right|327px|]]
+
* '''''Ulva linza''''' is a green macroalga (seaweed) that is widely used as a model organism in marine biofouling studies, which reproduces by production of spores that rapidly develop into sporelings. It is well known for its distribution in all aquatic habitats including freshwater, brackish environments, marine and fully saline environments throughout the warm temperate and tropical regions of the world. It must cope with dramatic changes because of tidal changes in light intensity, temperature, salinity, and wave action and with the biotic stresses characteristic of dense coastal ecosystems<ref name="ref1"/><ref name="ref2"/>.
* U. linza is a green macroalga (seaweed) that is widely used as a model organism in marine biofouling studies. Reproduction is facilitated by the release of motile, pear-shaped zoospores, 5每8 米m in length that are surrounded by a lipoprotein plasma membrane, ie there is no polysaccharide cell wall. Spores have a negative zeta potential, are negatively phototactic and also respond to a number of surface cues eg wettability, charge and topography. Settlement involves rapid secretion of a glycoprotein adhesive and permanent attachment to the substratum, retraction of the four flagella resulting in loss of motility, and the formation of a polysaccharide-rich cell wall. Permanently attached zoospores are rounded and typically 4-5 μm in diameter. Settlement (ie permanent attachment) is followed by germination of the attached spore, cell division and eventually the formation of a new adult plant<ref name="ref1"/> <ref name="ref2"/> .
+
* <font color=blue>'''Common Name:'''</font> '''Green alga'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=63409 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Experimental Conditions'''''==
 
=='''''Different Experimental Conditions'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 65: Line 66:
 
*'''Name''': Meitao Dong
 
*'''Name''': Meitao Dong
 
*'''Email''': yenh@ysfri.ac.cn
 
*'''Email''': yenh@ysfri.ac.cn
*'''Institute''':  Qingdao Agricultural University, Qingdao 266109, China
+
*'''Institution''':  Qingdao Agricultural University, Qingdao 266109, China
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''19''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=15623853099325924173&as_sdt=2005&sciodt=0,5&hl=en '''20'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 78: Line 80:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
Line 84: Line 88:
 
[[Category:18S rRNA]] [[Category:Histone]] [[Category:Tubulin]]
 
[[Category:18S rRNA]] [[Category:Histone]] [[Category:Tubulin]]
 
[[Category:Salinity Treatment]]  [[Category:Abiotic Stress]]  [[Category:Desiccation]]  [[Category:Air Temperature]]  [[Category:UV Treatment]]
 
[[Category:Salinity Treatment]]  [[Category:Abiotic Stress]]  [[Category:Desiccation]]  [[Category:Air Temperature]]  [[Category:UV Treatment]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 05:37, 1 September 2017

Description

Ulva linza.png
  • Ulva linza is a green macroalga (seaweed) that is widely used as a model organism in marine biofouling studies, which reproduces by production of spores that rapidly develop into sporelings. It is well known for its distribution in all aquatic habitats including freshwater, brackish environments, marine and fully saline environments throughout the warm temperate and tropical regions of the world. It must cope with dramatic changes because of tidal changes in light intensity, temperature, salinity, and wave action and with the biotic stresses characteristic of dense coastal ecosystems[1][2].
  • Common Name: Green alga
  • NCBI Taxonomy

Different Experimental Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TUB2[1] Tubulin2
  • Salinity treatments
  • UV treatments
JN543389
  • F:TGGAATCAACTACCAGCCAC
  • R:CGTACATCAGGTCAAACTTGTG
NA 60 SYBR
H2[1] Histone 2
  • Different temperature treatments
  • Desiccation stress treatments
JN543390
  • F:CTACAAGACAGACCTTCGCTTC
  • R:CATCCTTGGGCATAATAGTGAC
NA 60 SYBR
18S[1] 18S rRNA
  • Different light intensity treatments
HM584731
  • F:TGCCTAGTAAGCGCGAGTCA
  • R:AAACGATGGGCAGGGAAAC
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Meitao Dong
  • Email: yenh@ysfri.ac.cn
  • Institution: Qingdao Agricultural University, Qingdao 266109, China

Citation Statistics

Cited by 20 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Dong M, Zhang X, Chi X, et al. The validity of a reference gene is highly dependent on the experimental conditions in green alga Ulva linza[J]. Current genetics, 2012, 58(1): 13-20.
  2. Heydt M, Div車s P, Grunze M, Rosenhahn A. 2009. Analysis of holographic microscopy data to quantitatively investigate three-dimensional settlement dynamics of algal zoospores in the vicinity of surfaces. Eur Phys J E. 30:141-148.

Categories