Ulva linza

From ICG
Jump to navigation Jump to search

Description

Ulva linza-1.jpg
  • U. linza is a green macroalga (seaweed) that is widely used as a model organism in marine biofouling studies. Reproduction is facilitated by the release of motile, pear-shaped zoospores, 5每8 米m in length that are surrounded by a lipoprotein plasma membrane, ie there is no polysaccharide cell wall. Spores have a negative zeta potential, are negatively phototactic and also respond to a number of surface cues eg wettability, charge and topography. Settlement involves rapid secretion of a glycoprotein adhesive and permanent attachment to the substratum, retraction of the four flagella resulting in loss of motility, and the formation of a polysaccharide-rich cell wall. Permanently attached zoospores are rounded and typically 4-5 μm in diameter. Settlement (ie permanent attachment) is followed by germination of the attached spore, cell division and eventually the formation of a new adult plant[1] [2] .

Different Experimental Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TUB2[1] tubulin2
  • Salinity treatments
  • UV treatments
JN543389
  • F:TGGAATCAACTACCAGCCAC
  • R:CGTACATCAGGTCAAACTTGTG
NA 60 SYBR
H2[1] Histone 2
  • Different temperature treatments
  • Desiccation stress treatments
JN543390
  • F:CTACAAGACAGACCTTCGCTTC
  • R:CATCCTTGGGCATAATAGTGAC
NA 60 SYBR
18S[1] 18S rRNA
  • Different light intensity treatments
HM584731
  • F:TGCCTAGTAAGCGCGAGTCA
  • R:AAACGATGGGCAGGGAAAC
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Meitao Dong
  • Email: yenh@ysfri.ac.cn
  • Institute: Qingdao Agricultural University, Qingdao 266109, China

Citation Statistics

Cited by 19 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Dong M, Zhang X, Chi X, et al. The validity of a reference gene is highly dependent on the experimental conditions in green alga Ulva linza[J]. Current genetics, 2012, 58(1): 13-20.
  2. Heydt M, Div車s P, Grunze M, Rosenhahn A. 2009. Analysis of holographic microscopy data to quantitatively investigate three-dimensional settlement dynamics of algal zoospores in the vicinity of surfaces. Eur Phys J E. 30:141每148.