Ulva linza

Name: Meitao Dong
Email: yenh@ysfri.ac.cn
Institution: Qingdao Agricultural University, Qingdao 266109, China

Description

U. linza is a green macroalga (seaweed) that is widely used as a model organism in marine biofouling studies. Reproduction is facilitated by the release of motile, pear-shaped zoospores, 5每8 米m in length that are surrounded by a lipoprotein plasma membrane, ie there is no polysaccharide cell wall. Spores have a negative zeta potential, are negatively phototactic and also respond to a number of surface cues eg wettability, charge and topography. Settlement involves rapid secretion of a glycoprotein adhesive and permanent attachment to the substratum, retraction of the four flagella resulting in loss of motility, and the formation of a polysaccharide-rich cell wall. Permanently attached zoospores are rounded and typically 4-5 μm in diameter. Settlement (ie permanent attachment) is followed by germination of the attached spore, cell division and eventually the formation of a new adult plant^[1] ^[2] .

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
TUB2^[1]	Tubulin2	Salinity treatments UV treatments	JN543389	F:TGGAATCAACTACCAGCCAC R:CGTACATCAGGTCAAACTTGTG	NA	60	SYBR
H2^[1]	Histone 2	Different temperature treatments Desiccation stress treatments	JN543390	F:CTACAAGACAGACCTTCGCTTC R:CATCCTTGGGCATAATAGTGAC	NA	60	SYBR
18S^[1]	18S rRNA	Different light intensity treatments	HM584731	F:TGCCTAGTAAGCGCGAGTCA R:AAACGATGGGCAGGGAAAC	NA	60	SYBR

Cited by 19 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Dong M, Zhang X, Chi X, et al. The validity of a reference gene is highly dependent on the experimental conditions in green alga Ulva linza[J]. Current genetics, 2012, 58(1): 13-20.
↑ Heydt M, Div車s P, Grunze M, Rosenhahn A. 2009. Analysis of holographic microscopy data to quantitatively investigate three-dimensional settlement dynamics of algal zoospores in the vicinity of surfaces. Eur Phys J E. 30:141-148.