Difference between revisions of "Vernicia fordii"

From ICG
Jump to navigation Jump to search
 
(5 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:REFqPCRVernicia fordii.jpg|right|127px|]]
+
[[File:Vernicia fordii.png|right|200px|link=Vernicia fordii]]
  
 
*'''''Vernicia fordii Hemsl.''''', a species of the genus Vernicia in the spurge (Euphorbiaceae) family, is a kind of subtropical round-crowned deciduous tree. Tung oil extracted from its seeds is considered to be one of the high-value industrial oils, used widely in production of cloth, shoes, waterproofing masonry, clothing, paper and biodiesel. Tung oil is regarded as a conjugated drying oil with a high degree of unsaturation of fatty acids (80% α-eleostearic acid). Following the development and maturation of tung tree seeds, the content of fatty acids gradually increases.
 
*'''''Vernicia fordii Hemsl.''''', a species of the genus Vernicia in the spurge (Euphorbiaceae) family, is a kind of subtropical round-crowned deciduous tree. Tung oil extracted from its seeds is considered to be one of the high-value industrial oils, used widely in production of cloth, shoes, waterproofing masonry, clothing, paper and biodiesel. Tung oil is regarded as a conjugated drying oil with a high degree of unsaturation of fatty acids (80% α-eleostearic acid). Following the development and maturation of tung tree seeds, the content of fatty acids gradually increases.
Line 7: Line 7:
  
 
=='''''Seed Development'''''==
 
=='''''Seed Development'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 81: Line 81:
 
*'''Institution''': State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, People’s Republic of China
 
*'''Institution''': State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, People’s Republic of China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''63''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=11132487502526914264&as_sdt=2005&sciodt=0,5&hl=en '''65'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 89: Line 89:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
 
[[Category:mRNA]]   
 
[[Category:mRNA]]   
Line 97: Line 99:
 
[[Category:Ubiquitin]]
 
[[Category:Ubiquitin]]
 
[[Category:Seed Development]]
 
[[Category:Seed Development]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 05:39, 1 September 2017

Description

Vernicia fordii.png
  • Vernicia fordii Hemsl., a species of the genus Vernicia in the spurge (Euphorbiaceae) family, is a kind of subtropical round-crowned deciduous tree. Tung oil extracted from its seeds is considered to be one of the high-value industrial oils, used widely in production of cloth, shoes, waterproofing masonry, clothing, paper and biodiesel. Tung oil is regarded as a conjugated drying oil with a high degree of unsaturation of fatty acids (80% α-eleostearic acid). Following the development and maturation of tung tree seeds, the content of fatty acids gradually increases.
  • Common Name: Tung tree
  • NCBI Taxonomy

Seed Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT7[1] Actin7a
  • Seed development
JQ680035
  • F:CGATGAAGCACAGTCCAAA
  • R:AGGTTGAGAGGAGCCTCAGTG
170 82.36 SYBR
EF1a[1] Elongation factor 1-alpha
  • Seed development
JQ680036
  • F:GCCTGGTATGGTTGTGACCT
  • R:GGATCATCCTTGGAGTTGGA
180 84.01 SYBR
UBQ[1] Ubiquitin
  • Seed development
JQ680041
  • F:CCGTGGTGGCTGTTAAGTTT
  • R:AAGGCCATTTCAACATCCTG
193 80.71 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Seed development
JQ680038
  • F:CTGCTAAGGCTGTTGGGAAG
  • R:TCCCTCTGACTCCTCCTTGA
168 83.55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiaojiao Han
  • Email: wyd11111@126.com
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, People’s Republic of China

Citation Statistics

Cited by 65 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Han X, Lu M, Chen Y, et al. Selection of reliable reference genes for gene expression studies using real-time PCR in tung tree during seed development[J]. PloS one, 2012, 7(8): e43084.

Categories