Difference between revisions of "Vernicia fordii"

From ICG
Jump to navigation Jump to search
Line 91: Line 91:
 
</references>
 
</references>
 
[[Category:Plants]]
 
[[Category:Plants]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 03:32, 19 June 2017

Description

REFqPCRVernicia fordii.jpg
  • Tung tree (Vernicia fordii Hemsl.), a subtropical round-crowned deciduous tree, belongs to a species of the genus Vernicia in the spurge (Euphorbiaceae) family.
  • Tung oil extracted from seeds is considered to be one of the high-value industrial oils, used widely in production of cloth, shoes, waterproofing masonry, clothing, paper, and biodiesel.
  • With 80% α-eleostearic acid of tung oil, a high degree of unsaturation, tung oil is regarded as a conjugated drying oil.
  • Following the development and maturation of tung tree seeds, the content of fatty acids gradually increases. The peak periods of fatty acid synthesis are during the middle of August and the middle of September in China.

Seed Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT7[1] Actin7a
  • Seed development
JQ680035
  • F:CGATGAAGCACAGTCCAAA
  • R:AGGTTGAGAGGAGCCTCAGTG
170 82.36 SYBR
EF1a[1] Elongation factor 1-alpha
  • Seed development
JQ680036
  • F:GCCTGGTATGGTTGTGACCT
  • R:GGATCATCCTTGGAGTTGGA
180 84.01 SYBR
UBQ[1] Ubiquitin
  • Seed development
JQ680041
  • F:CCGTGGTGGCTGTTAAGTTT
  • R:AAGGCCATTTCAACATCCTG
193 80.71 SYBR
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase
  • Seed development
JQ680038
  • F:CTGCTAAGGCTGTTGGGAAG
  • R:TCCCTCTGACTCCTCCTTGA
168 83.55 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiaojiao Han
  • Email: wyd11111@126.com
  • Institute: State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, People’s Republic of China

Citation Statistics

Cited by 64 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Han X, Lu M, Chen Y, et al. Selection of reliable reference genes for gene expression studies using real-time PCR in tung tree during seed development[J]. PloS one, 2012, 7(8): e43084.