Difference between revisions of "Vernicia fordii"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''''Seed Development'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene symbol ! Gene name ! st...")
 
Line 4: Line 4:
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
! Gene symbol  
+
! Gene Symbol  
! Gene name
+
! Gene Name
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
Line 62: Line 62:
 
|}
 
|}
  
===Moleculer types===
+
===Moleculer Types===
 
* mRNA
 
* mRNA
  
Line 74: Line 74:
 
*'''Email''': wyd11111@126.com
 
*'''Email''': wyd11111@126.com
 
*'''Institute''': State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, People’s Republic of China
 
*'''Institute''': State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, People’s Republic of China
 +
===Citation Statistics===
 +
Cited by '''64''' (Based on Google Scholar [2017-06-16])
  
 
=='''References'''==
 
=='''References'''==

Revision as of 10:30, 16 June 2017

Description

Seed Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT7[1] Actin7a
  • Seed Development
JQ680035
  • F:CGATGAAGCACAGTCCAAA
  • R:AGGTTGAGAGGAGCCTCAGTG
170 82.36 SYBR
EF1a[1] Elongation factor 1-alpha
  • Seed Development
JQ680036
  • F:GCCTGGTATGGTTGTGACCT
  • R:GGATCATCCTTGGAGTTGGA
180 84.01 SYBR
UBQ[1] Ubiquitin
  • Seed Development
JQ680041
  • F:CCGTGGTGGCTGTTAAGTTT
  • R:AAGGCCATTTCAACATCCTG
193 80.71 SYBR
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase
  • Seed Development
JQ680038
  • F:CTGCTAAGGCTGTTGGGAAG
  • R:TCCCTCTGACTCCTCCTTGA
168 83.55 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiaojiao Han
  • Email: wyd11111@126.com
  • Institute: State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, People’s Republic of China

Citation Statistics

Cited by 64 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Han X, Lu M, Chen Y, et al. Selection of reliable reference genes for gene expression studies using real-time PCR in tung tree during seed development[J]. PloS one, 2012, 7(8): e43084.