Difference between revisions of "Vernicia fordii"

From ICG
Jump to navigation Jump to search
Line 83: Line 83:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
[[Category:Plants]]

Revision as of 10:31, 16 June 2017

Description

Seed Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT7[1] Actin7a
  • Seed Development
JQ680035
  • F:CGATGAAGCACAGTCCAAA
  • R:AGGTTGAGAGGAGCCTCAGTG
170 82.36 SYBR
EF1a[1] Elongation factor 1-alpha
  • Seed Development
JQ680036
  • F:GCCTGGTATGGTTGTGACCT
  • R:GGATCATCCTTGGAGTTGGA
180 84.01 SYBR
UBQ[1] Ubiquitin
  • Seed Development
JQ680041
  • F:CCGTGGTGGCTGTTAAGTTT
  • R:AAGGCCATTTCAACATCCTG
193 80.71 SYBR
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase
  • Seed Development
JQ680038
  • F:CTGCTAAGGCTGTTGGGAAG
  • R:TCCCTCTGACTCCTCCTTGA
168 83.55 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiaojiao Han
  • Email: wyd11111@126.com
  • Institute: State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, People’s Republic of China

Citation Statistics

Cited by 64 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Han X, Lu M, Chen Y, et al. Selection of reliable reference genes for gene expression studies using real-time PCR in tung tree during seed development[J]. PloS one, 2012, 7(8): e43084.