Difference between revisions of "Vigna mungo"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== =='''''Biotic and Abiotic stress'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name !...")
 
Line 1: Line 1:
 
==Description==
 
==Description==
 +
 +
[[File:Vigna mungo-1.jpg|right|327px|]]
 +
* Cultivated blackgram (Vigna mungo) is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation. Substantial progress has already been made in V. mungo breeding; the present effort is now directed toward integration of genomics in crop improvement.
 +
* Moreover, rapid advancement in legume genome sequencing coupled with high-throughput expression analysis has resulted in mining of agronomically vital genes, implicating their deployment in the development of superior cultivars. All these studies often need an efficient tool such as qPCR to analyze the expression levels of some responsive genes to develop logistic improvement of the crop<ref name="ref1"/> <ref name="ref2"/>.
 +
 
=='''''Biotic and Abiotic stress'''''==
 
=='''''Biotic and Abiotic stress'''''==
 
===Reference Genes===
 
===Reference Genes===
Line 78: Line 83:
 
<ref name="ref1">
 
<ref name="ref1">
 
Kundu A, Patel A, Pal A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo[J]. Plant cell reports, 2013, 32(10): 1647-1658.
 
Kundu A, Patel A, Pal A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo[J]. Plant cell reports, 2013, 32(10): 1647-1658.
 +
</ref>
 +
<ref name="ref2">
 +
Basak J, Kundagramy S, Ghose TK, Pal A (2005) Development of yellow mosaic virus (YMV) resistance linked DNA-marker in Vigna mungo from population segregating for YMV reaction. Mol Breed 14:375–383 
 
</ref>
 
</ref>
 
</references>
 
</references>

Revision as of 08:56, 16 June 2017

Description

Vigna mungo-1.jpg
  • Cultivated blackgram (Vigna mungo) is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation. Substantial progress has already been made in V. mungo breeding; the present effort is now directed toward integration of genomics in crop improvement.
  • Moreover, rapid advancement in legume genome sequencing coupled with high-throughput expression analysis has resulted in mining of agronomically vital genes, implicating their deployment in the development of superior cultivars. All these studies often need an efficient tool such as qPCR to analyze the expression levels of some responsive genes to develop logistic improvement of the crop[1] [2].

Biotic and Abiotic stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT[1] actin
  • Mungbean yellow mosaic India virus infection
  • salinity stress
JZ078743
  • F:GTTCTGTTCCAGCCATCCAT
  • R:GTGGTGCGACAACCTTGATT
220 83.5 SYBR
EF1A[1] Elongation factor 1-alpha
  • Mungbean yellow mosaic India virus infection
HO223992
  • F:CCTCTTGGACGTTTTGCTGT
  • R:TGTAACCATCCCCTGATGA
157 85.5 SYBR
H2A[1] histone H2A
  • Drought treatments
JG016051
  • F:GATGACACCACCACCAACAA
  • R:GCTGGGAATGCAAGTAAGGA
126 83.0 SYBR
18S[1] 18S rRNA
  • Drought treatments
JZ078742
  • F:CTCTGCCTGTTGCTTTGATG
  • R:CTCTGCCTGTTGCTTTGATG
152 85.5 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Amita Pal
  • Email: amita_pal@yahoo.com
  • Institution: Division of Plant Biology, Bose Institute, Kolkata 700054,West Bengal, India

References

  1. 1.0 1.1 1.2 1.3 1.4 Kundu A, Patel A, Pal A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo[J]. Plant cell reports, 2013, 32(10): 1647-1658.
  2. Basak J, Kundagramy S, Ghose TK, Pal A (2005) Development of yellow mosaic virus (YMV) resistance linked DNA-marker in Vigna mungo from population segregating for YMV reaction. Mol Breed 14:375–383