Difference between revisions of "Vigna mungo"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
==Description==
 
==Description==
  
[[File:Vigna mungo-1.jpg|right|327px|]]
+
[[File:Vigna mungo.png|right|200px|link=Vigna mungo]]
 
* '''''Cultivated blackgram (Vigna mungo)''''' is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation. Substantial progress has already been made in V. mungo breeding; the present effort is now directed toward integration of genomics in crop improvement. Moreover, rapid advancement in legume genome sequencing coupled with high-throughput expression analysis has resulted in mining of agronomically vital genes, implicating their deployment in the development of superior cultivars. <ref name="ref1"/> <ref name="ref2"/>.
 
* '''''Cultivated blackgram (Vigna mungo)''''' is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation. Substantial progress has already been made in V. mungo breeding; the present effort is now directed toward integration of genomics in crop improvement. Moreover, rapid advancement in legume genome sequencing coupled with high-throughput expression analysis has resulted in mining of agronomically vital genes, implicating their deployment in the development of superior cultivars. <ref name="ref1"/> <ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Black gram''', '''Urad bean'''
 
* <font color=blue>'''Common Name:'''</font> '''Black gram''', '''Urad bean'''

Revision as of 03:53, 29 June 2017

Description

Vigna mungo.png
  • Cultivated blackgram (Vigna mungo) is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation. Substantial progress has already been made in V. mungo breeding; the present effort is now directed toward integration of genomics in crop improvement. Moreover, rapid advancement in legume genome sequencing coupled with high-throughput expression analysis has resulted in mining of agronomically vital genes, implicating their deployment in the development of superior cultivars. [1] [2].
  • Common Name: Black gram, Urad bean
  • NCBI Taxonomy

Biotic and Abiotic stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT[1] Actin
  • Mungbean yellow mosaic India virus infection
  • Salinity stress
JZ078743
  • F:GTTCTGTTCCAGCCATCCAT
  • R:GTGGTGCGACAACCTTGATT
220 83.5 SYBR
EF1A[1] Elongation factor 1-alpha
  • Mungbean yellow mosaic India virus infection
HO223992
  • F:CCTCTTGGACGTTTTGCTGT
  • R:TGTAACCATCCCCTGATGA
157 85.5 SYBR
H2A[1] Histone H2A
  • Drought treatments
JG016051
  • F:GATGACACCACCACCAACAA
  • R:GCTGGGAATGCAAGTAAGGA
126 83.0 SYBR
18S[1] 18S rRNA
  • Drought treatments
JZ078742
  • F:CTCTGCCTGTTGCTTTGATG
  • R:CTCTGCCTGTTGCTTTGATG
152 85.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Amita Pal
  • Email: amita_pal@yahoo.com
  • Institution: Division of Plant Biology, Bose Institute, Kolkata 700054,West Bengal, India

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-06-16])


References

  1. 1.0 1.1 1.2 1.3 1.4 Kundu A, Patel A, Pal A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo[J]. Plant cell reports, 2013, 32(10): 1647-1658.
  2. Basak J, Kundagramy S, Ghose TK, Pal A (2005) Development of yellow mosaic virus (YMV) resistance linked DNA-marker in Vigna mungo from population segregating for YMV reaction. Mol Breed 14:375–383.