Difference between revisions of "Vigna mungo"

From ICG
Jump to navigation Jump to search
Line 2: Line 2:
  
 
[[File:Vigna mungo.png|right|200px|link=Vigna mungo]]
 
[[File:Vigna mungo.png|right|200px|link=Vigna mungo]]
* '''''Cultivated blackgram (Vigna mungo)''''' is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation. <ref name="ref1"/> <ref name="ref2"/>.
+
* '''''Vigna mungo''''' is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation<ref name="ref1"/><ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Black gram''', '''Urad bean'''
 
* <font color=blue>'''Common Name:'''</font> '''Black gram''', '''Urad bean'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3915 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3915 <font color=blue>'''NCBI Taxonomy'''</font>]

Revision as of 09:40, 29 June 2017

Description

Vigna mungo.png
  • Vigna mungo is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation[1][2].
  • Common Name: Black gram, Urad bean
  • NCBI Taxonomy

Biotic and Abiotic stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT[1] Actin
  • Mungbean yellow mosaic India virus infection
  • Salinity stress
JZ078743
  • F:GTTCTGTTCCAGCCATCCAT
  • R:GTGGTGCGACAACCTTGATT
220 83.5 SYBR
EF1A[1] Elongation factor 1-alpha
  • Mungbean yellow mosaic India virus infection
HO223992
  • F:CCTCTTGGACGTTTTGCTGT
  • R:TGTAACCATCCCCTGATGA
157 85.5 SYBR
H2A[1] Histone H2A
  • Drought treatments
JG016051
  • F:GATGACACCACCACCAACAA
  • R:GCTGGGAATGCAAGTAAGGA
126 83.0 SYBR
18S[1] 18S rRNA
  • Drought treatments
JZ078742
  • F:CTCTGCCTGTTGCTTTGATG
  • R:CTCTGCCTGTTGCTTTGATG
152 85.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Amita Pal
  • Email: amita_pal@yahoo.com
  • Institution: Division of Plant Biology, Bose Institute, Kolkata 700054,West Bengal, India

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-06-16])


References

  1. 1.0 1.1 1.2 1.3 1.4 Kundu A, Patel A, Pal A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo[J]. Plant cell reports, 2013, 32(10): 1647-1658.
  2. Basak J, Kundagramy S, Ghose TK, Pal A (2005) Development of yellow mosaic virus (YMV) resistance linked DNA-marker in Vigna mungo from population segregating for YMV reaction. Mol Breed 14:375–383.