Difference between revisions of "Vigna mungo"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== =='''''Biotic and Abiotic stress'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name !...")
 
 
(19 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
 +
 +
[[File:Vigna mungo.png|right|200px|link=Vigna mungo]]
 +
* '''''Vigna mungo''''' is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Black gram''', '''Urad bean'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3915 <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
=='''''Biotic and Abiotic stress'''''==
 
=='''''Biotic and Abiotic stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 8: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 14: Line 20:
 
|-
 
|-
 
|align="center"| ACT<ref name="ref1"/>
 
|align="center"| ACT<ref name="ref1"/>
|align="center"| actin
+
|align="center"| Actin
 
|
 
|
 
* Mungbean yellow mosaic India virus infection
 
* Mungbean yellow mosaic India virus infection
* salinity stress  
+
* Salinity stress  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/JZ078743 '''JZ078743''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/JZ078743 '''JZ078743''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 39: Line 45:
 
|-
 
|-
 
|align="center"| H2A<ref name="ref1"/>
 
|align="center"| H2A<ref name="ref1"/>
|align="center"| histone H2A
+
|align="center"| Histone H2A
 
|
 
|
 
* Drought treatments  
 
* Drought treatments  
Line 63: Line 69:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 73: Line 80:
 
*'''Email''': amita_pal@yahoo.com
 
*'''Email''': amita_pal@yahoo.com
 
*'''Institution''': Division of Plant Biology, Bose Institute, Kolkata 700054,West Bengal, India
 
*'''Institution''': Division of Plant Biology, Bose Institute, Kolkata 700054,West Bengal, India
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=14528871251214737958&as_sdt=2005&sciodt=0,5&hl=en '''25'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 78: Line 87:
 
<ref name="ref1">
 
<ref name="ref1">
 
Kundu A, Patel A, Pal A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo[J]. Plant cell reports, 2013, 32(10): 1647-1658.
 
Kundu A, Patel A, Pal A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo[J]. Plant cell reports, 2013, 32(10): 1647-1658.
 +
</ref>
 +
<ref name="ref2">
 +
Basak J, Kundagramy S, Ghose TK, Pal A (2005) Development of yellow mosaic virus (YMV) resistance linked DNA-marker in Vigna mungo from population segregating for YMV reaction. Mol Breed 14:375–383. 
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 +
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 +
[[Category:18S rRNA]] [[Category:ACT]] [[Category:EF1α]] [[Category:Histone]][[Category:Biotic Stress]]  [[Category:Abiotic Stress]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 05:41, 1 September 2017

Description

Vigna mungo.png
  • Vigna mungo is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation[1][2].
  • Common Name: Black gram, Urad bean
  • NCBI Taxonomy

Biotic and Abiotic stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT[1] Actin
  • Mungbean yellow mosaic India virus infection
  • Salinity stress
JZ078743
  • F:GTTCTGTTCCAGCCATCCAT
  • R:GTGGTGCGACAACCTTGATT
220 83.5 SYBR
EF1A[1] Elongation factor 1-alpha
  • Mungbean yellow mosaic India virus infection
HO223992
  • F:CCTCTTGGACGTTTTGCTGT
  • R:TGTAACCATCCCCTGATGA
157 85.5 SYBR
H2A[1] Histone H2A
  • Drought treatments
JG016051
  • F:GATGACACCACCACCAACAA
  • R:GCTGGGAATGCAAGTAAGGA
126 83.0 SYBR
18S[1] 18S rRNA
  • Drought treatments
JZ078742
  • F:CTCTGCCTGTTGCTTTGATG
  • R:CTCTGCCTGTTGCTTTGATG
152 85.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Amita Pal
  • Email: amita_pal@yahoo.com
  • Institution: Division of Plant Biology, Bose Institute, Kolkata 700054,West Bengal, India

Citation Statistics

Cited by 25 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Kundu A, Patel A, Pal A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo[J]. Plant cell reports, 2013, 32(10): 1647-1658.
  2. Basak J, Kundagramy S, Ghose TK, Pal A (2005) Development of yellow mosaic virus (YMV) resistance linked DNA-marker in Vigna mungo from population segregating for YMV reaction. Mol Breed 14:375–383.

Categories