Difference between revisions of "Vigna mungo"

From ICG
Jump to navigation Jump to search
 
(18 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
  
−
[[File:Vigna mungo-1.jpg|right|327px|]]
+
[[File:Vigna mungo.png|right|200px|link=Vigna mungo]]
−
* Cultivated blackgram (Vigna mungo) is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation. Substantial progress has already been made in V. mungo breeding; the present effort is now directed toward integration of genomics in crop improvement.
+
* '''''Vigna mungo''''' is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation<ref name="ref1"/><ref name="ref2"/>.
−
* Moreover, rapid advancement in legume genome sequencing coupled with high-throughput expression analysis has resulted in mining of agronomically vital genes, implicating their deployment in the development of superior cultivars. All these studies often need an efficient tool such as qPCR to analyze the expression levels of some responsive genes to develop logistic improvement of the crop<ref name="ref1"/> <ref name="ref2"/>.
+
* <font color=blue>'''Common Name:'''</font> '''Black gram''', '''Urad bean'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3915 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Biotic and Abiotic stress'''''==
 
=='''''Biotic and Abiotic stress'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 14:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 19: Line 20:
 
|-
 
|-
 
|align="center"| ACT<ref name="ref1"/>
 
|align="center"| ACT<ref name="ref1"/>
−
|align="center"| actin
+
|align="center"| Actin
 
|
 
|
 
* Mungbean yellow mosaic India virus infection
 
* Mungbean yellow mosaic India virus infection
−
* salinity stress  
+
* Salinity stress  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/JZ078743 '''JZ078743''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/JZ078743 '''JZ078743''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 44: Line 45:
 
|-
 
|-
 
|align="center"| H2A<ref name="ref1"/>
 
|align="center"| H2A<ref name="ref1"/>
−
|align="center"| histone H2A
+
|align="center"| Histone H2A
 
|
 
|
 
* Drought treatments  
 
* Drought treatments  
Line 68: Line 69:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 78: Line 80:
 
*'''Email''': amita_pal@yahoo.com
 
*'''Email''': amita_pal@yahoo.com
 
*'''Institution''': Division of Plant Biology, Bose Institute, Kolkata 700054,West Bengal, India
 
*'''Institution''': Division of Plant Biology, Bose Institute, Kolkata 700054,West Bengal, India
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=14528871251214737958&as_sdt=2005&sciodt=0,5&hl=en '''25'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 85: Line 89:
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
−
Basak J, Kundagramy S, Ghose TK, Pal A (2005) Development of yellow mosaic virus (YMV) resistance linked DNA-marker in Vigna mungo from population segregating for YMV reaction. Mol Breed 14:375–383   
+
Basak J, Kundagramy S, Ghose TK, Pal A (2005) Development of yellow mosaic virus (YMV) resistance linked DNA-marker in Vigna mungo from population segregating for YMV reaction. Mol Breed 14:375–383.  
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 +
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 +
[[Category:18S rRNA]] [[Category:ACT]] [[Category:EF1α]] [[Category:Histone]][[Category:Biotic Stress]]  [[Category:Abiotic Stress]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 05:41, 1 September 2017

Description

Vigna mungo.png
  • Vigna mungo is an annual, selfpollinated grain legume consumed for its high-quality edible protein throughout the world. Besides its use in global cuisine, it is also an eminent restorer of soil fertility through biological nitrogen fixation[1][2].
  • Common Name: Black gram, Urad bean
  • NCBI Taxonomy

Biotic and Abiotic stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
ACT[1] Actin
  • Mungbean yellow mosaic India virus infection
  • Salinity stress
 JZ078743
  • F:GTTCTGTTCCAGCCATCCAT
  • R:GTGGTGCGACAACCTTGATT
 220 83.5 SYBR
EF1A[1] Elongation factor 1-alpha
  • Mungbean yellow mosaic India virus infection
 HO223992
  • F:CCTCTTGGACGTTTTGCTGT
  • R:TGTAACCATCCCCTGATGA
 157 85.5 SYBR
H2A[1] Histone H2A
  • Drought treatments
 JG016051
  • F:GATGACACCACCACCAACAA
  • R:GCTGGGAATGCAAGTAAGGA
 126 83.0 SYBR
18S[1] 18S rRNA
  • Drought treatments
 JZ078742
  • F:CTCTGCCTGTTGCTTTGATG
  • R:CTCTGCCTGTTGCTTTGATG
 152 85.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Amita Pal
  • Email: amita_pal@yahoo.com
  • Institution: Division of Plant Biology, Bose Institute, Kolkata 700054,West Bengal, India

Citation Statistics

Cited by 25 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 Kundu A, Patel A, Pal A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo[J]. Plant cell reports, 2013, 32(10): 1647-1658.
  2. ↑ Basak J, Kundagramy S, Ghose TK, Pal A (2005) Development of yellow mosaic virus (YMV) resistance linked DNA-marker in Vigna mungo from population segregating for YMV reaction. Mol Breed 14:375–383.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Vigna_mungo&oldid=8663"