Vigna mungo

From ICG
Revision as of 07:27, 16 June 2017 by ICG Expert4 (talk | contribs) (Created page with "==Description== =='''''Biotic and Abiotic stress'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name !...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Biotic and Abiotic stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT[1] actin
  • Mungbean yellow mosaic India virus infection
  • salinity stress
JZ078743
  • F:GTTCTGTTCCAGCCATCCAT
  • R:GTGGTGCGACAACCTTGATT
220 83.5 SYBR
EF1A[1] Elongation factor 1-alpha
  • Mungbean yellow mosaic India virus infection
HO223992
  • F:CCTCTTGGACGTTTTGCTGT
  • R:TGTAACCATCCCCTGATGA
157 85.5 SYBR
H2A[1] histone H2A
  • Drought treatments
JG016051
  • F:GATGACACCACCACCAACAA
  • R:GCTGGGAATGCAAGTAAGGA
126 83.0 SYBR
18S[1] 18S rRNA
  • Drought treatments
JZ078742
  • F:CTCTGCCTGTTGCTTTGATG
  • R:CTCTGCCTGTTGCTTTGATG
152 85.5 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Amita Pal
  • Email: amita_pal@yahoo.com
  • Institution: Division of Plant Biology, Bose Institute, Kolkata 700054,West Bengal, India

References

  1. 1.0 1.1 1.2 1.3 Kundu A, Patel A, Pal A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo[J]. Plant cell reports, 2013, 32(10): 1647-1658.