Difference between revisions of "Vitis vinifera"

From ICG
Jump to navigation Jump to search
Line 89: Line 89:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
[[Category:Plants]]

Revision as of 10:09, 16 June 2017

Description

  • Grapevine is one of the most cultivated fruit crop worldwide with Vitis vinifera being the species with the highest economical importance due to the high quality standards of its berries.

Downy Mildew Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
UBQ[1] Ubiquitin-conjugating enzyme
  • Genotype effect
  • Biotic stress effect
  • Resistant cultivar Regent
EC922622
  • F:GAGGGTCGTCAGGATTTGGA
  • R:GCCCTGCACTTACCATCTTTAAG
75 60 SYBR
EF1a[1] Elongation factor 1a
  • Genotype effect
  • Susceptible cultivar trincadeira
  • Resistant cultivar regent
EC959059
  • F:GAACTGGGTGCTTGATAGGC
  • R:ACCAAAATATCCGGAGTAAAAGA
164 60 SYBR
GAPDH[1] glyceraldehyde-3-phosphate dehy-drogenase
  • Genotype effect
  • Resistant cultivar regent
EF192466
  • F:TCAAGGTCAAGGACTCTAACACC
  • R:CCAACAACGAACATAGGAGCA
226 60 SYBR
SAND[1] SAND family protein
  • Susceptible cultivar trincadeira
CF405409
  • F:CAACATCCTTTACCCATTGACAGA
  • R:GCATTTGATCCACTTGCAGATAAG
76 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Filipa Monteiro
  • Email: fimonteiro@fc.ul.pt
  • Institute: Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal

Citation Statistics

Cited by 29 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.