Difference between revisions of "Vitis vinifera"

From ICG
Jump to navigation Jump to search
Line 82: Line 82:
 
===Citation Statistics===
 
===Citation Statistics===
 
Cited by '''29''' (Based on Google Scholar [2017-06-16])
 
Cited by '''29''' (Based on Google Scholar [2017-06-16])
 +
 +
=='''Involved In Pterostilbene Synthesis'''==
 +
 +
===Reference Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25% font-size:9pt "|Application Scope
 +
! Accession Number
 +
! Primer
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| VATP16<ref name="ref2"/>
 +
|align="center"| V-type proton ATPase 16 kDa proteolipid subunit
 +
|
 +
in grapevine leaves and berries infected by P. viticola and B. cinerea
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002269086.2?report=genbank '''XM_002269086''']
 +
|nowrap style="font-size:9pt"|
 +
* F:CTTCTCCTGTATGGGAGCTG
 +
* R:CCATAACAACTGGTACAATCGAC
 +
|align="center"| 112
 +
|align="center"| 85.23
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| 60SRP<ref name="ref2"/>
 +
|align="center"| 60S ribosomal protein L18
 +
|
 +
in grapevine leaves and berries infected by P. viticola and B. cinerea
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002270599 '''XM_002270599''']
 +
|nowrap style="font-size:9pt"|
 +
* F:ATCTACCTCAAGCTCCTAGTC
 +
* R:CAATCTTGTCCTCCTTTCCT
 +
|align="center"| 165
 +
|align="center"| 82.39
 +
|align="center"| SYBR
 +
|}
 +
===Moleculer types===
 +
* mRNA
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Marielle Adrian
 +
*'''Email''': marielle.adrian@u-bourgogne.fr
 +
*'''Institute''': Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France
  
 
=='''References'''==
 
=='''References'''==

Revision as of 14:26, 16 June 2017

Description

  • Grapevine is one of the most cultivated fruit crop worldwide with Vitis vinifera being the species with the highest economical importance due to the high quality standards of its berries.

Downy Mildew Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
UBQ[1] Ubiquitin-conjugating enzyme
  • Genotype effect
  • Biotic stress effect
  • Resistant cultivar Regent
EC922622
  • F:GAGGGTCGTCAGGATTTGGA
  • R:GCCCTGCACTTACCATCTTTAAG
75 60 SYBR
EF1a[1] Elongation factor 1a
  • Genotype effect
  • Susceptible cultivar trincadeira
  • Resistant cultivar regent
EC959059
  • F:GAACTGGGTGCTTGATAGGC
  • R:ACCAAAATATCCGGAGTAAAAGA
164 60 SYBR
GAPDH[1] glyceraldehyde-3-phosphate dehy-drogenase
  • Genotype effect
  • Resistant cultivar regent
EF192466
  • F:TCAAGGTCAAGGACTCTAACACC
  • R:CCAACAACGAACATAGGAGCA
226 60 SYBR
SAND[1] SAND family protein
  • Susceptible cultivar trincadeira
CF405409
  • F:CAACATCCTTTACCCATTGACAGA
  • R:GCATTTGATCCACTTGCAGATAAG
76 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Filipa Monteiro
  • Email: fimonteiro@fc.ul.pt
  • Institute: Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal

Citation Statistics

Cited by 29 (Based on Google Scholar [2017-06-16])

Involved In Pterostilbene Synthesis

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
VATP16[2] V-type proton ATPase 16 kDa proteolipid subunit

in grapevine leaves and berries infected by P. viticola and B. cinerea

XM_002269086
  • F:CTTCTCCTGTATGGGAGCTG
  • R:CCATAACAACTGGTACAATCGAC
112 85.23 SYBR
60SRP[2] 60S ribosomal protein L18

in grapevine leaves and berries infected by P. viticola and B. cinerea

XM_002270599
  • F:ATCTACCTCAAGCTCCTAGTC
  • R:CAATCTTGTCCTCCTTTCCT
165 82.39 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Marielle Adrian
  • Email: marielle.adrian@u-bourgogne.fr
  • Institute: Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France

References

  1. 1.0 1.1 1.2 1.3 Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.
  2. 2.0 2.1 Cite error: Invalid <ref> tag; no text was provided for refs named ref2