Difference between revisions of "Vitis vinifera"

From ICG
Jump to navigation Jump to search
 
(15 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:Vitis vinifera.png|right|200px|link=Vitis vinifera]]
 
* '''''Vitis vinifera''''' is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes. There are currently between 5,000 and 10,000 varieties of grapes though only a few are of commercial significance for wine and table grape production.
 
* '''''Vitis vinifera''''' is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes. There are currently between 5,000 and 10,000 varieties of grapes though only a few are of commercial significance for wine and table grape production.
 
* <font color=blue>'''Common Name:'''</font> '''Common grape vine'''
 
* <font color=blue>'''Common Name:'''</font> '''Common grape vine'''
Line 5: Line 6:
  
 
=='''''Mycotic Infection'''''==
 
=='''''Mycotic Infection'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 75: Line 76:
 
|}
 
|}
  
===Molecular Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 89: Line 90:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''29''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=4712925854124704127&as_sdt=2005&sciodt=0,5&hl=en '''32'''] (Based on Google Scholar [2017-08-10])
  
 
=='''''Pterostilbene Synthesis'''''==
 
=='''''Pterostilbene Synthesis'''''==
Line 109: Line 110:
 
|
 
|
 
*In grapevine leaves and berries infected by P. viticola and B. cinerea
 
*In grapevine leaves and berries infected by P. viticola and B. cinerea
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002269086.2?report=genbank '''XM_002269086''']  
+
|align="center"| [https://www.ncbi.nlm.nih.gov/gene/100248726 '''LOC100248726''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CTTCTCCTGTATGGGAGCTG
 
* F:CTTCTCCTGTATGGGAGCTG
Line 129: Line 130:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Molecular types===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 140: Line 142:
 
*'''Email''': marielle.adrian@u-bourgogne.fr
 
*'''Email''': marielle.adrian@u-bourgogne.fr
 
*'''Institution''': Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France
 
*'''Institution''': Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France
Cited by '''42''' (Based on Google Scholar [2017-06-23])
+
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=9611952445134277019&as_sdt=2005&sciodt=0,5&hl=en '''44'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 151: Line 154:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]]
+
 
[[Category:mRNA]]
+
=='''Categories'''==
[[Category:SYBR]]
+
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]] [[Category:RPL]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:SAND]] [[Category:Ubiquitin]] [[Category:VATP]] [[Category:Fungal infection]]  [[Category:Biotic Stress]]  [[Category:Pathological conditions]] [[Category:geNorm]] [[Category:NormFinder]] [[Category:BestKeeper]]
[[Category:60SRP]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:SAND]] [[Category:Ubiquitin]] [[Category:VATP]]
 
[[Category:Fungal infection]]  [[Category:Biotic Stress]]  [[Category:Pathological conditions]]
 

Latest revision as of 05:51, 1 September 2017

Description

Vitis vinifera.png
  • Vitis vinifera is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes. There are currently between 5,000 and 10,000 varieties of grapes though only a few are of commercial significance for wine and table grape production.
  • Common Name: Common grape vine
  • NCBI Taxonomy

Mycotic Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBQ[1] Ubiquitin-conjugating enzyme
  • Genotype effect
  • Biotic stress effect
  • Resistant cultivar regent
  • Downy mildew infection
EC922622
  • F:GAGGGTCGTCAGGATTTGGA
  • R:GCCCTGCACTTACCATCTTTAAG
75 60 SYBR
EF1a[1] Elongation factor 1a
  • Genotype effect
  • Susceptible cultivar trincadeira
  • Resistant cultivar regent
  • Downy mildew infection
EC959059
  • F:GAACTGGGTGCTTGATAGGC
  • R:ACCAAAATATCCGGAGTAAAAGA
164 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehy-drogenase
  • Genotype effect
  • Resistant cultivar regent
  • Downy mildew infection
EF192466
  • F:TCAAGGTCAAGGACTCTAACACC
  • R:CCAACAACGAACATAGGAGCA
226 60 SYBR
SAND[1] SAND family protein
  • Susceptible cultivar trincadeira
  • Downy mildew infection
CF405409
  • F:CAACATCCTTTACCCATTGACAGA
  • R:GCATTTGATCCACTTGCAGATAAG
76 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Filipa Monteiro
  • Email: fimonteiro@fc.ul.pt
  • Institution: Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal

Citation Statistics

Cited by 32 (Based on Google Scholar [2017-08-10])

Pterostilbene Synthesis

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
VATP16[2] V-type proton ATPase 16 kDa proteolipid subunit
  • In grapevine leaves and berries infected by P. viticola and B. cinerea
LOC100248726
  • F:CTTCTCCTGTATGGGAGCTG
  • R:CCATAACAACTGGTACAATCGAC
112 85.23 SYBR
60SRP[2] 60S ribosomal protein L18
  • In grapevine leaves and berries infected by P. viticola and B. cinerea
XM_002270599
  • F:ATCTACCTCAAGCTCCTAGTC
  • R:CAATCTTGTCCTCCTTTCCT
165 82.39 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Marielle Adrian
  • Email: marielle.adrian@u-bourgogne.fr
  • Institution: Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France

Citation Statistics

Cited by 44 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.
  2. 2.0 2.1 Gamm M, Héloir M C, Kelloniemi J, et al. Identification of reference genes suitable for qRT-PCR in grapevine and application for the study of the expression of genes involved in pterostilbene synthesis[J]. Molecular Genetics and Genomics, 2011, 285(4): 273-285.

Categories