Difference between revisions of "Vitis vinifera"
Jump to navigation
Jump to search
ICG Expert3 (talk | contribs) |
Niu Guangyi (talk | contribs) |
||
(15 intermediate revisions by 6 users not shown) | |||
Line 1: | Line 1: | ||
=='''Description'''== | =='''Description'''== | ||
+ | [[File:Vitis vinifera.png|right|200px|link=Vitis vinifera]] | ||
* '''''Vitis vinifera''''' is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes. There are currently between 5,000 and 10,000 varieties of grapes though only a few are of commercial significance for wine and table grape production. | * '''''Vitis vinifera''''' is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes. There are currently between 5,000 and 10,000 varieties of grapes though only a few are of commercial significance for wine and table grape production. | ||
* <font color=blue>'''Common Name:'''</font> '''Common grape vine''' | * <font color=blue>'''Common Name:'''</font> '''Common grape vine''' | ||
Line 5: | Line 6: | ||
=='''''Mycotic Infection'''''== | =='''''Mycotic Infection'''''== | ||
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 75: | Line 76: | ||
|} | |} | ||
− | ===Molecular | + | ===Molecular Types=== |
* mRNA | * mRNA | ||
Line 89: | Line 90: | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=4712925854124704127&as_sdt=2005&sciodt=0,5&hl=en '''32'''] (Based on Google Scholar [2017-08-10]) |
=='''''Pterostilbene Synthesis'''''== | =='''''Pterostilbene Synthesis'''''== | ||
Line 109: | Line 110: | ||
| | | | ||
*In grapevine leaves and berries infected by P. viticola and B. cinerea | *In grapevine leaves and berries infected by P. viticola and B. cinerea | ||
− | |align="center"| [https://www.ncbi.nlm.nih.gov/ | + | |align="center"| [https://www.ncbi.nlm.nih.gov/gene/100248726 '''LOC100248726'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:CTTCTCCTGTATGGGAGCTG | * F:CTTCTCCTGTATGGGAGCTG | ||
Line 129: | Line 130: | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|} | |} | ||
− | ===Molecular | + | |
+ | ===Molecular Types=== | ||
* mRNA | * mRNA | ||
Line 140: | Line 142: | ||
*'''Email''': marielle.adrian@u-bourgogne.fr | *'''Email''': marielle.adrian@u-bourgogne.fr | ||
*'''Institution''': Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France | *'''Institution''': Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France | ||
− | Cited by ''' | + | ===Citation Statistics=== |
+ | Cited by [https://scholar.google.com/scholar?cites=9611952445134277019&as_sdt=2005&sciodt=0,5&hl=en '''44'''] (Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
Line 151: | Line 154: | ||
</ref> | </ref> | ||
</references> | </references> | ||
− | [[Category:Plants]] | + | |
− | [[Category:mRNA]] | + | =='''Categories'''== |
− | [[Category:SYBR]] | + | [[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]] [[Category:RPL]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:SAND]] [[Category:Ubiquitin]] [[Category:VATP]] [[Category:Fungal infection]] [[Category:Biotic Stress]] [[Category:Pathological conditions]] [[Category:geNorm]] [[Category:NormFinder]] [[Category:BestKeeper]] |
− | [[Category: | ||
− | [[Category:Fungal infection]] [[Category:Biotic Stress]] [[Category:Pathological conditions]] |
Latest revision as of 05:51, 1 September 2017
Contents
Description
- Vitis vinifera is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes. There are currently between 5,000 and 10,000 varieties of grapes though only a few are of commercial significance for wine and table grape production.
- Common Name: Common grape vine
- NCBI Taxonomy
Mycotic Infection
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
UBQ[1] | Ubiquitin-conjugating enzyme |
|
EC922622 |
|
75 | 60 | SYBR |
EF1a[1] | Elongation factor 1a |
|
EC959059 |
|
164 | 60 | SYBR |
GAPDH[1] | Glyceraldehyde-3-phosphate dehy-drogenase |
|
EF192466 |
|
226 | 60 | SYBR |
SAND[1] | SAND family protein |
|
CF405409 |
|
76 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Filipa Monteiro
- Email: fimonteiro@fc.ul.pt
- Institution: Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal
Citation Statistics
Cited by 32 (Based on Google Scholar [2017-08-10])
Pterostilbene Synthesis
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
VATP16[2] | V-type proton ATPase 16 kDa proteolipid subunit |
|
LOC100248726 |
|
112 | 85.23 | SYBR |
60SRP[2] | 60S ribosomal protein L18 |
|
XM_002270599 |
|
165 | 82.39 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Marielle Adrian
- Email: marielle.adrian@u-bourgogne.fr
- Institution: Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France
Citation Statistics
Cited by 44 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.
- ↑ 2.0 2.1 Gamm M, Héloir M C, Kelloniemi J, et al. Identification of reference genes suitable for qRT-PCR in grapevine and application for the study of the expression of genes involved in pterostilbene synthesis[J]. Molecular Genetics and Genomics, 2011, 285(4): 273-285.