Difference between revisions of "Vitis vinifera"
Jump to navigation
Jump to search
ICG Expert3 (talk | contribs) |
Niu Guangyi (talk | contribs) |
||
(29 intermediate revisions by 7 users not shown) | |||
Line 1: | Line 1: | ||
=='''Description'''== | =='''Description'''== | ||
− | * | + | [[File:Vitis vinifera.png|right|200px|link=Vitis vinifera]] |
− | ==''' | + | * '''''Vitis vinifera''''' is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes. There are currently between 5,000 and 10,000 varieties of grapes though only a few are of commercial significance for wine and table grape production. |
− | === | + | * <font color=blue>'''Common Name:'''</font> '''Common grape vine''' |
+ | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=29760 <font color=blue>'''NCBI Taxonomy'''</font>] | ||
+ | |||
+ | =='''''Mycotic Infection'''''== | ||
+ | ===Internal Control Genes=== | ||
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 9: | Line 13: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 20: | Line 24: | ||
* Biotic stress effect | * Biotic stress effect | ||
* Resistant cultivar regent | * Resistant cultivar regent | ||
+ | * Downy mildew infection | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EC922622 '''EC922622'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EC922622 '''EC922622'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 34: | Line 39: | ||
* Susceptible cultivar trincadeira | * Susceptible cultivar trincadeira | ||
* Resistant cultivar regent | * Resistant cultivar regent | ||
+ | * Downy mildew infection | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EC959059 '''EC959059'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EC959059 '''EC959059'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 43: | Line 49: | ||
|- | |- | ||
|align="center"| GAPDH<ref name="ref1"/> | |align="center"| GAPDH<ref name="ref1"/> | ||
− | |align="center"| | + | |align="center"| Glyceraldehyde-3-phosphate dehy-drogenase |
| | | | ||
* Genotype effect | * Genotype effect | ||
* Resistant cultivar regent | * Resistant cultivar regent | ||
+ | * Downy mildew infection | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF192466 '''EF192466'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF192466 '''EF192466'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 59: | Line 66: | ||
| | | | ||
* Susceptible cultivar trincadeira | * Susceptible cultivar trincadeira | ||
+ | * Downy mildew infection | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CF405409 '''CF405409'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CF405409 '''CF405409'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 68: | Line 76: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
* mRNA | * mRNA | ||
Line 79: | Line 87: | ||
*'''Name''': Filipa Monteiro | *'''Name''': Filipa Monteiro | ||
*'''Email''': fimonteiro@fc.ul.pt | *'''Email''': fimonteiro@fc.ul.pt | ||
− | *''' | + | *'''Institution''': Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal |
+ | |||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=4712925854124704127&as_sdt=2005&sciodt=0,5&hl=en '''32'''] (Based on Google Scholar [2017-08-10]) |
− | ==''' | + | =='''''Pterostilbene Synthesis'''''== |
===Reference Genes=== | ===Reference Genes=== | ||
Line 92: | Line 101: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 101: | Line 110: | ||
| | | | ||
*In grapevine leaves and berries infected by P. viticola and B. cinerea | *In grapevine leaves and berries infected by P. viticola and B. cinerea | ||
− | |align="center"| [https://www.ncbi.nlm.nih.gov/ | + | |align="center"| [https://www.ncbi.nlm.nih.gov/gene/100248726 '''LOC100248726'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:CTTCTCCTGTATGGGAGCTG | * F:CTTCTCCTGTATGGGAGCTG | ||
Line 121: | Line 130: | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|} | |} | ||
− | === | + | |
+ | ===Molecular Types=== | ||
* mRNA | * mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 130: | Line 141: | ||
*'''Name''': Marielle Adrian | *'''Name''': Marielle Adrian | ||
*'''Email''': marielle.adrian@u-bourgogne.fr | *'''Email''': marielle.adrian@u-bourgogne.fr | ||
− | *''' | + | *'''Institution''': Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France |
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=9611952445134277019&as_sdt=2005&sciodt=0,5&hl=en '''44'''] (Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
Line 141: | Line 154: | ||
</ref> | </ref> | ||
</references> | </references> | ||
− | [[Category:Plants]] | + | |
− | [[Category:mRNA]] | + | =='''Categories'''== |
− | [[Category:SYBR]] | + | [[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]] [[Category:RPL]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:SAND]] [[Category:Ubiquitin]] [[Category:VATP]] [[Category:Fungal infection]] [[Category:Biotic Stress]] [[Category:Pathological conditions]] [[Category:geNorm]] [[Category:NormFinder]] [[Category:BestKeeper]] |
Latest revision as of 05:51, 1 September 2017
Contents
Description
- Vitis vinifera is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes. There are currently between 5,000 and 10,000 varieties of grapes though only a few are of commercial significance for wine and table grape production.
- Common Name: Common grape vine
- NCBI Taxonomy
Mycotic Infection
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
UBQ[1] | Ubiquitin-conjugating enzyme |
|
EC922622 |
|
75 | 60 | SYBR |
EF1a[1] | Elongation factor 1a |
|
EC959059 |
|
164 | 60 | SYBR |
GAPDH[1] | Glyceraldehyde-3-phosphate dehy-drogenase |
|
EF192466 |
|
226 | 60 | SYBR |
SAND[1] | SAND family protein |
|
CF405409 |
|
76 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Filipa Monteiro
- Email: fimonteiro@fc.ul.pt
- Institution: Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal
Citation Statistics
Cited by 32 (Based on Google Scholar [2017-08-10])
Pterostilbene Synthesis
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
VATP16[2] | V-type proton ATPase 16 kDa proteolipid subunit |
|
LOC100248726 |
|
112 | 85.23 | SYBR |
60SRP[2] | 60S ribosomal protein L18 |
|
XM_002270599 |
|
165 | 82.39 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Marielle Adrian
- Email: marielle.adrian@u-bourgogne.fr
- Institution: Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France
Citation Statistics
Cited by 44 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.
- ↑ 2.0 2.1 Gamm M, Héloir M C, Kelloniemi J, et al. Identification of reference genes suitable for qRT-PCR in grapevine and application for the study of the expression of genes involved in pterostilbene synthesis[J]. Molecular Genetics and Genomics, 2011, 285(4): 273-285.