Difference between revisions of "Vitis vinifera"

From ICG
Jump to navigation Jump to search
(Created page with "__NOTITLE__ =='''Description'''== * Grapevine is one of the most cultivated fruit crop worldwide with ''Vitis vinifera'' being the species with the highest economical importan...")
 
 
(37 intermediate revisions by 7 users not shown)
Line 1: Line 1:
−
__NOTITLE__
 
 
=='''Description'''==
 
=='''Description'''==
−
* Grapevine is one of the most cultivated fruit crop worldwide with ''Vitis vinifera'' being the species with the highest economical importance due to the high quality standards of its berries.
+
[[File:Vitis vinifera.png|right|200px|link=Vitis vinifera]]
−
=='''Downy Mildew Infection'''==
+
* '''''Vitis vinifera''''' is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes. There are currently between 5,000 and 10,000 varieties of grapes though only a few are of commercial significance for wine and table grape production.
−
===Reference Genes===
+
* <font color=blue>'''Common Name:'''</font> '''Common grape vine'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=29760 <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
 +
=='''''Mycotic Infection'''''==
 +
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
 
! Gene Symbol   
 
! Gene Symbol   
−
! Gene name
+
! Gene Name
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 20: Line 23:
 
* Genotype effect  
 
* Genotype effect  
 
* Biotic stress effect  
 
* Biotic stress effect  
−
* Resistant cultivar Regent
+
* Resistant cultivar regent
 +
* Downy mildew infection
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/EC922622 '''EC922622''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/EC922622 '''EC922622''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 35: Line 39:
 
* Susceptible cultivar trincadeira  
 
* Susceptible cultivar trincadeira  
 
* Resistant cultivar regent  
 
* Resistant cultivar regent  
 +
* Downy mildew infection
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/EC959059 '''EC959059''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/EC959059 '''EC959059''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 44: Line 49:
 
|-
 
|-
 
|align="center"| GAPDH<ref name="ref1"/>
 
|align="center"| GAPDH<ref name="ref1"/>
−
|align="center"| glyceraldehyde-3-phosphate dehy-drogenase
+
|align="center"| Glyceraldehyde-3-phosphate dehy-drogenase
 
|
 
|
 
* Genotype effect
 
* Genotype effect
 
* Resistant cultivar regent
 
* Resistant cultivar regent
 +
* Downy mildew infection
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/EF192466 '''EF192466''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/EF192466 '''EF192466''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 60: Line 66:
 
|
 
|
 
* Susceptible cultivar trincadeira  
 
* Susceptible cultivar trincadeira  
 +
* Downy mildew infection
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/CF405409 '''CF405409''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/CF405409 '''CF405409''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 69: Line 76:
 
|}
 
|}
  
−
===Moleculer Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 80: Line 87:
 
*'''Name''': Filipa Monteiro
 
*'''Name''': Filipa Monteiro
 
*'''Email''': fimonteiro@fc.ul.pt
 
*'''Email''': fimonteiro@fc.ul.pt
−
*'''Institute''':  Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal
+
*'''Institution''':  Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal
 +
 
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=4712925854124704127&as_sdt=2005&sciodt=0,5&hl=en '''32'''] (Based on Google Scholar [2017-08-10])
 +
 
 +
=='''''Pterostilbene Synthesis'''''==
 +
 
 +
===Reference Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25%　font-size:9pt　"|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| VATP16<ref name="ref2"/>
 +
|align="center"| V-type proton ATPase 16 kDa proteolipid subunit
 +
|
 +
*In grapevine leaves and berries infected by P. viticola and B. cinerea
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/gene/100248726 '''LOC100248726''']
 +
|nowrap style="font-size:9pt"|
 +
* F:CTTCTCCTGTATGGGAGCTG
 +
* R:CCATAACAACTGGTACAATCGAC
 +
|align="center"| 112
 +
|align="center"| 85.23
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| 60SRP<ref name="ref2"/>
 +
|align="center"| 60S ribosomal protein L18
 +
|
 +
*In grapevine leaves and berries infected by P. viticola and B. cinerea
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002270599 '''XM_002270599''']
 +
|nowrap style="font-size:9pt"|
 +
* F:ATCTACCTCAAGCTCCTAGTC
 +
* R:CAATCTTGTCCTCCTTTCCT
 +
|align="center"| 165
 +
|align="center"| 82.39
 +
|align="center"| SYBR
 +
|}
 +
 
 +
===Molecular Types===
 +
* mRNA
 +
 
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Marielle Adrian
 +
*'''Email''': marielle.adrian@u-bourgogne.fr
 +
*'''Institution''': Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=9611952445134277019&as_sdt=2005&sciodt=0,5&hl=en '''44'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 86: Line 149:
 
<ref name="ref1">
 
<ref name="ref1">
 
Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.
 
Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.
 +
</ref>
 +
<ref name="ref2">
 +
Gamm M, Héloir M C, Kelloniemi J, et al. Identification of reference genes suitable for qRT-PCR in grapevine and application for the study of the expression of genes involved in pterostilbene synthesis[J]. Molecular Genetics and Genomics, 2011, 285(4): 273-285.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 +
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]] [[Category:RPL]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:SAND]] [[Category:Ubiquitin]] [[Category:VATP]] [[Category:Fungal infection]]  [[Category:Biotic Stress]]  [[Category:Pathological conditions]] [[Category:geNorm]] [[Category:NormFinder]] [[Category:BestKeeper]]

Latest revision as of 05:51, 1 September 2017

Description

Vitis vinifera.png
  • Vitis vinifera is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes. There are currently between 5,000 and 10,000 varieties of grapes though only a few are of commercial significance for wine and table grape production.
  • Common Name: Common grape vine
  • NCBI Taxonomy

Mycotic Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
UBQ[1] Ubiquitin-conjugating enzyme
  • Genotype effect
  • Biotic stress effect
  • Resistant cultivar regent
  • Downy mildew infection
 EC922622
  • F:GAGGGTCGTCAGGATTTGGA
  • R:GCCCTGCACTTACCATCTTTAAG
 75 60 SYBR
EF1a[1] Elongation factor 1a
  • Genotype effect
  • Susceptible cultivar trincadeira
  • Resistant cultivar regent
  • Downy mildew infection
 EC959059
  • F:GAACTGGGTGCTTGATAGGC
  • R:ACCAAAATATCCGGAGTAAAAGA
 164 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehy-drogenase
  • Genotype effect
  • Resistant cultivar regent
  • Downy mildew infection
 EF192466
  • F:TCAAGGTCAAGGACTCTAACACC
  • R:CCAACAACGAACATAGGAGCA
 226 60 SYBR
SAND[1] SAND family protein
  • Susceptible cultivar trincadeira
  • Downy mildew infection
 CF405409
  • F:CAACATCCTTTACCCATTGACAGA
  • R:GCATTTGATCCACTTGCAGATAAG
 76 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Filipa Monteiro
  • Email: fimonteiro@fc.ul.pt
  • Institution: Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal

Citation Statistics

Cited by 32 (Based on Google Scholar [2017-08-10])

Pterostilbene Synthesis

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
VATP16[2] V-type proton ATPase 16 kDa proteolipid subunit
  • In grapevine leaves and berries infected by P. viticola and B. cinerea
 LOC100248726
  • F:CTTCTCCTGTATGGGAGCTG
  • R:CCATAACAACTGGTACAATCGAC
 112 85.23 SYBR
60SRP[2] 60S ribosomal protein L18
  • In grapevine leaves and berries infected by P. viticola and B. cinerea
 XM_002270599
  • F:ATCTACCTCAAGCTCCTAGTC
  • R:CAATCTTGTCCTCCTTTCCT
 165 82.39 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Marielle Adrian
  • Email: marielle.adrian@u-bourgogne.fr
  • Institution: Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France

Citation Statistics

Cited by 44 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.
  2. ↑ 2.0 2.1 Gamm M, Héloir M C, Kelloniemi J, et al. Identification of reference genes suitable for qRT-PCR in grapevine and application for the study of the expression of genes involved in pterostilbene synthesis[J]. Molecular Genetics and Genomics, 2011, 285(4): 273-285.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Vitis_vinifera&oldid=8666"