Difference between revisions of "Vitis vinifera"

From ICG
Jump to navigation Jump to search
Line 9: Line 9:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 20: Line 20:
 
* Biotic stress effect  
 
* Biotic stress effect  
 
* Resistant cultivar regent  
 
* Resistant cultivar regent  
* Downy Mildew Infection
+
* Downy mildew infection
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/EC922622 '''EC922622''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/EC922622 '''EC922622''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 35: Line 35:
 
* Susceptible cultivar trincadeira  
 
* Susceptible cultivar trincadeira  
 
* Resistant cultivar regent  
 
* Resistant cultivar regent  
* Downy Mildew Infection
+
* Downy mildew infection
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/EC959059 '''EC959059''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/EC959059 '''EC959059''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 49: Line 49:
 
* Genotype effect
 
* Genotype effect
 
* Resistant cultivar regent
 
* Resistant cultivar regent
* Downy Mildew Infection
+
* Downy mildew infection
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/EF192466 '''EF192466''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/EF192466 '''EF192466''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 62: Line 62:
 
|
 
|
 
* Susceptible cultivar trincadeira  
 
* Susceptible cultivar trincadeira  
* Downy Mildew Infection
+
* Downy mildew infection
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/CF405409 '''CF405409''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/CF405409 '''CF405409''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 96: Line 96:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]

Revision as of 09:04, 20 June 2017

Description

  • Grapevine is one of the most cultivated fruit crop worldwide with Vitis vinifera being the species with the highest economical importance due to the high quality standards of its berries.

Mycotic Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBQ[1] Ubiquitin-conjugating enzyme
  • Genotype effect
  • Biotic stress effect
  • Resistant cultivar regent
  • Downy mildew infection
EC922622
  • F:GAGGGTCGTCAGGATTTGGA
  • R:GCCCTGCACTTACCATCTTTAAG
75 60 SYBR
EF1a[1] Elongation factor 1a
  • Genotype effect
  • Susceptible cultivar trincadeira
  • Resistant cultivar regent
  • Downy mildew infection
EC959059
  • F:GAACTGGGTGCTTGATAGGC
  • R:ACCAAAATATCCGGAGTAAAAGA
164 60 SYBR
GAPDH[1] glyceraldehyde-3-phosphate dehy-drogenase
  • Genotype effect
  • Resistant cultivar regent
  • Downy mildew infection
EF192466
  • F:TCAAGGTCAAGGACTCTAACACC
  • R:CCAACAACGAACATAGGAGCA
226 60 SYBR
SAND[1] SAND family protein
  • Susceptible cultivar trincadeira
  • Downy mildew infection
CF405409
  • F:CAACATCCTTTACCCATTGACAGA
  • R:GCATTTGATCCACTTGCAGATAAG
76 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Filipa Monteiro
  • Email: fimonteiro@fc.ul.pt
  • Institute: Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal

Citation Statistics

Cited by 29 (Based on Google Scholar [2017-06-16])

Pterostilbene Synthesis

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
VATP16[2] V-type proton ATPase 16 kDa proteolipid subunit
  • In grapevine leaves and berries infected by P. viticola and B. cinerea
XM_002269086
  • F:CTTCTCCTGTATGGGAGCTG
  • R:CCATAACAACTGGTACAATCGAC
112 85.23 SYBR
60SRP[2] 60S ribosomal protein L18
  • In grapevine leaves and berries infected by P. viticola and B. cinerea
XM_002270599
  • F:ATCTACCTCAAGCTCCTAGTC
  • R:CAATCTTGTCCTCCTTTCCT
165 82.39 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Marielle Adrian
  • Email: marielle.adrian@u-bourgogne.fr
  • Institute: Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France

References

  1. 1.0 1.1 1.2 1.3 Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.
  2. 2.0 2.1 Gamm M, Héloir M C, Kelloniemi J, et al. Identification of reference genes suitable for qRT-PCR in grapevine and application for the study of the expression of genes involved in pterostilbene synthesis[J]. Molecular Genetics and Genomics, 2011, 285(4): 273-285.