Difference between revisions of "Vitis vinifera"
Jump to navigation
Jump to search
ICG Expert3 (talk | contribs) |
|||
Line 82: | Line 82: | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
Cited by '''29''' (Based on Google Scholar [2017-06-16]) | Cited by '''29''' (Based on Google Scholar [2017-06-16]) | ||
+ | |||
+ | =='''Involved In Pterostilbene Synthesis'''== | ||
+ | |||
+ | ===Reference Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primer | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| VATP16<ref name="ref2"/> | ||
+ | |align="center"| V-type proton ATPase 16 kDa proteolipid subunit | ||
+ | | | ||
+ | in grapevine leaves and berries infected by P. viticola and B. cinerea | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002269086.2?report=genbank '''XM_002269086'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CTTCTCCTGTATGGGAGCTG | ||
+ | * R:CCATAACAACTGGTACAATCGAC | ||
+ | |align="center"| 112 | ||
+ | |align="center"| 85.23 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| 60SRP<ref name="ref2"/> | ||
+ | |align="center"| 60S ribosomal protein L18 | ||
+ | | | ||
+ | in grapevine leaves and berries infected by P. viticola and B. cinerea | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002270599 '''XM_002270599'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:ATCTACCTCAAGCTCCTAGTC | ||
+ | * R:CAATCTTGTCCTCCTTTCCT | ||
+ | |align="center"| 165 | ||
+ | |align="center"| 82.39 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | ===Moleculer types=== | ||
+ | * mRNA | ||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
+ | * [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': Marielle Adrian | ||
+ | *'''Email''': marielle.adrian@u-bourgogne.fr | ||
+ | *'''Institute''': Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France | ||
=='''References'''== | =='''References'''== |
Revision as of 14:26, 16 June 2017
Contents
Description
- Grapevine is one of the most cultivated fruit crop worldwide with Vitis vinifera being the species with the highest economical importance due to the high quality standards of its berries.
Downy Mildew Infection
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
UBQ[1] | Ubiquitin-conjugating enzyme |
|
EC922622 |
|
75 | 60 | SYBR |
EF1a[1] | Elongation factor 1a |
|
EC959059 |
|
164 | 60 | SYBR |
GAPDH[1] | glyceraldehyde-3-phosphate dehy-drogenase |
|
EF192466 |
|
226 | 60 | SYBR |
SAND[1] | SAND family protein |
|
CF405409 |
|
76 | 60 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Filipa Monteiro
- Email: fimonteiro@fc.ul.pt
- Institute: Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal
Citation Statistics
Cited by 29 (Based on Google Scholar [2017-06-16])
Involved In Pterostilbene Synthesis
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
VATP16[2] | V-type proton ATPase 16 kDa proteolipid subunit |
in grapevine leaves and berries infected by P. viticola and B. cinerea |
XM_002269086 |
|
112 | 85.23 | SYBR |
60SRP[2] | 60S ribosomal protein L18 |
in grapevine leaves and berries infected by P. viticola and B. cinerea |
XM_002270599 |
|
165 | 82.39 | SYBR |
Moleculer types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Marielle Adrian
- Email: marielle.adrian@u-bourgogne.fr
- Institute: Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France
References
- ↑ 1.0 1.1 1.2 1.3 Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.
- ↑ 2.0 2.1 Cite error: Invalid
<ref>
tag; no text was provided for refs namedref2