Vitis vinifera

Description

Grapevine is one of the most cultivated fruit crop worldwide with Vitis vinifera being the species with the highest economical importance due to the high quality standards of its berries.

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
UBQ^[1]	Ubiquitin-conjugating enzyme	Genotype effect Biotic stress effect Resistant cultivar regent Downy mildew infection	EC922622	F:GAGGGTCGTCAGGATTTGGA R:GCCCTGCACTTACCATCTTTAAG	75	60	SYBR
EF1a^[1]	Elongation factor 1a	Genotype effect Susceptible cultivar trincadeira Resistant cultivar regent Downy mildew infection	EC959059	F:GAACTGGGTGCTTGATAGGC R:ACCAAAATATCCGGAGTAAAAGA	164	60	SYBR
GAPDH^[1]	Glyceraldehyde-3-phosphate dehy-drogenase	Genotype effect Resistant cultivar regent Downy mildew infection	EF192466	F:TCAAGGTCAAGGACTCTAACACC R:CCAACAACGAACATAGGAGCA	226	60	SYBR
SAND^[1]	SAND family protein	Susceptible cultivar trincadeira Downy mildew infection	CF405409	F:CAACATCCTTTACCCATTGACAGA R:GCATTTGATCCACTTGCAGATAAG	76	60	SYBR

Name: Filipa Monteiro
Email: fimonteiro@fc.ul.pt
Institute: Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal

Cited by 29 (Based on Google Scholar [2017-06-16])

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
VATP16^[2]	V-type proton ATPase 16 kDa proteolipid subunit	In grapevine leaves and berries infected by P. viticola and B. cinerea	XM_002269086	F:CTTCTCCTGTATGGGAGCTG R:CCATAACAACTGGTACAATCGAC	112	85.23	SYBR
60SRP^[2]	60S ribosomal protein L18	In grapevine leaves and berries infected by P. viticola and B. cinerea	XM_002270599	F:ATCTACCTCAAGCTCCTAGTC R:CAATCTTGTCCTCCTTTCCT	165	82.39	SYBR

Name: Marielle Adrian
Email: marielle.adrian@u-bourgogne.fr
Institute: Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France

↑ ^1.0 ^1.1 ^1.2 ^1.3 Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.
↑ ^2.0 ^2.1 Gamm M, Héloir M C, Kelloniemi J, et al. Identification of reference genes suitable for qRT-PCR in grapevine and application for the study of the expression of genes involved in pterostilbene synthesis[J]. Molecular Genetics and Genomics, 2011, 285(4): 273-285.