Vitis vinifera

Description

Grapevine is one of the most cultivated fruit crop worldwide with Vitis vinifera being the species with the highest economical importance due to the high quality standards of its berries.

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
UBQ^[1]	Ubiquitin-conjugating enzyme	Genotype effect Biotic stress effect Resistant cultivar Regent	EC922622	F:GAGGGTCGTCAGGATTTGGA R:GCCCTGCACTTACCATCTTTAAG	75	60	SYBR
EF1a^[1]	Elongation factor 1a	Genotype effect Susceptible cultivar trincadeira Resistant cultivar regent	EC959059	F:GAACTGGGTGCTTGATAGGC R:ACCAAAATATCCGGAGTAAAAGA	164	60	SYBR
GAPDH^[1]	glyceraldehyde-3-phosphate dehy-drogenase	Genotype effect Resistant cultivar regent	EF192466	F:TCAAGGTCAAGGACTCTAACACC R:CCAACAACGAACATAGGAGCA	226	60	SYBR
SAND^[1]	SAND family protein	Susceptible cultivar trincadeira	CF405409	F:CAACATCCTTTACCCATTGACAGA R:GCATTTGATCCACTTGCAGATAAG	76	60	SYBR

Name: Filipa Monteiro
Email: fimonteiro@fc.ul.pt
Institute: Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal

Cited by 29 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.